Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000923572:

Variant ID: vg1000923572 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 923572
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAAACAAAACTTGAATAATACAAATAATCAAAAGTCTGCCTAAAATTCCATGGCGCCAAACATTGAAAACCGGAGAGAGCGTAGTAGTGAACAACATA[T/C]
CAATATGCATATGTATATCATGTTTAACTATAGAACATTTTACCGCTGACAAGTTTTGGGATGGCGATCGAGATTACCGGCCGGCAGCGCGCAACTTACA

Reverse complement sequence

TGTAAGTTGCGCGCTGCCGGCCGGTAATCTCGATCGCCATCCCAAAACTTGTCAGCGGTAAAATGTTCTATAGTTAAACATGATATACATATGCATATTG[A/G]
TATGTTGTTCACTACTACGCTCTCTCCGGTTTTCAATGTTTGGCGCCATGGAATTTTAGGCAGACTTTTGATTATTTGTATTATTCAAGTTTTGTTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.10%	29.80%	0.06%	0.00%	NA
All Indica	2759	99.00%	0.90%	0.04%	0.00%	NA
All Japonica	1512	10.80%	89.10%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.00%	0.13%	0.00%	NA
Temperate Japonica	767	2.60%	97.40%	0.00%	0.00%	NA
Tropical Japonica	504	18.30%	81.50%	0.20%	0.00%	NA
Japonica Intermediate	241	21.60%	78.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	37.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000923572	T -> C	LOC_Os10g02490.1	upstream_gene_variant ; 336.0bp to feature; MODIFIER	silent_mutation	Average:82.432; most accessible tissue: Minghui63 panicle, score: 89.444	N	N	N	N
vg1000923572	T -> C	LOC_Os10g02490.2	upstream_gene_variant ; 138.0bp to feature; MODIFIER	silent_mutation	Average:82.432; most accessible tissue: Minghui63 panicle, score: 89.444	N	N	N	N
vg1000923572	T -> C	LOC_Os10g02500.1	downstream_gene_variant ; 2780.0bp to feature; MODIFIER	silent_mutation	Average:82.432; most accessible tissue: Minghui63 panicle, score: 89.444	N	N	N	N
vg1000923572	T -> C	LOC_Os10g02480-LOC_Os10g02490	intergenic_region ; MODIFIER	silent_mutation	Average:82.432; most accessible tissue: Minghui63 panicle, score: 89.444	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1000923572	T	C	0.01	-0.02	-0.02	0.0	0.0	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000923572	8.38E-09	NA	Heading_date	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000923572	3.68E-06	NA	Heading_date	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000923572	NA	1.42E-22	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	2.20E-23	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	1.45E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	7.41E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	6.16E-20	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	9.79E-20	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	5.24E-46	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	1.52E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	8.16E-23	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	2.32E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	3.48E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	6.98E-18	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	4.88E-16	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000923572	NA	1.48E-20	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251