\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922675974:

Variant ID: vg0922675974 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22675974
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TTATAGTTTATACCCCTACATGAACATGAGGTTGTATGTATTTTGTTGATTGGTTTTTCAGAGAGCGTTTAGTTTAATTTTGGTCGTAGGTACGATATAT[A/G]
GGATATGGCGCTGTAATATGCATGACCAAGAGAATGTACAGATCGATATAATGTAGCATGACATGTACAGTACGTATGACAGTAGTCGTATTAATCGCCT

Reverse complement sequence

AGGCGATTAATACGACTACTGTCATACGTACTGTACATGTCATGCTACATTATATCGATCTGTACATTCTCTTGGTCATGCATATTACAGCGCCATATCC[T/C]
ATATATCGTACCTACGACCAAAATTAAACTAAACGCTCTCTGAAAAACCAATCAACAAAATACATACAACCTCATGTTCATGTAGGGGTATAAACTATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 11.20% 5.69% 1.95% NA
All Indica  2759 87.40% 1.70% 7.61% 3.30% NA
All Japonica  1512 80.40% 16.90% 2.78% 0.00% NA
Aus  269 19.30% 75.50% 5.20% 0.00% NA
Indica I  595 92.80% 0.00% 5.55% 1.68% NA
Indica II  465 92.50% 1.30% 4.52% 1.72% NA
Indica III  913 81.50% 1.30% 10.73% 6.46% NA
Indica Intermediate  786 87.20% 3.70% 7.38% 1.78% NA
Temperate Japonica  767 71.60% 24.00% 4.43% 0.00% NA
Tropical Japonica  504 95.40% 4.20% 0.40% 0.00% NA
Japonica Intermediate  241 76.80% 20.70% 2.49% 0.00% NA
VI/Aromatic  96 89.60% 7.30% 2.08% 1.04% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922675974 A -> G LOC_Os09g39430.1 upstream_gene_variant ; 533.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922675974 A -> G LOC_Os09g39420.1 downstream_gene_variant ; 4582.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922675974 A -> G LOC_Os09g39440.1 downstream_gene_variant ; 1586.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922675974 A -> G LOC_Os09g39440.2 downstream_gene_variant ; 1586.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922675974 A -> G LOC_Os09g39430-LOC_Os09g39440 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922675974 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0922675974 A G -0.03 0.05 0.0 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922675974 NA 1.18E-13 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0922675974 2.69E-06 NA Yield All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0922675974 NA 9.08E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922675974 NA 4.10E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922675974 NA 1.88E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922675974 NA 2.12E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922675974 NA 1.41E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922675974 NA 8.72E-08 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922675974 NA 5.86E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922675974 NA 2.68E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922675974 NA 9.86E-40 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922675974 NA 8.72E-08 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922675974 NA 1.49E-08 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922675974 NA 3.18E-36 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922675974 NA 2.58E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251