\
| Variant ID: vg0922468532 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22468532 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGATAATTAATTGCGGTAAAGAAGCCTTCATATTAAGCCAGACCACCCACGACACACACCTGACACCCCCATAGAATTAATGTGTCCCTGAAACATCCAT[A/T]
GCTAGATTATGAAGCCTACGGAAACAGCTCACTATGCCAAAATGGACTACCACCTTGCTTTCTCCTTAATCGATATCGCACCCAGCAAATCTTAATTTGT
ACAAATTAAGATTTGCTGGGTGCGATATCGATTAAGGAGAAAGCAAGGTGGTAGTCCATTTTGGCATAGTGAGCTGTTTCCGTAGGCTTCATAATCTAGC[T/A]
ATGGATGTTTCAGGGACACATTAATTCTATGGGGGTGTCAGGTGTGTGTCGTGGGTGGTCTGGCTTAATATGAAGGCTTCTTTACCGCAATTAATTATCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.00% | 5.80% | 2.26% | 48.92% | NA |
| All Indica | 2759 | 23.90% | 0.10% | 2.03% | 73.98% | NA |
| All Japonica | 1512 | 79.20% | 17.50% | 2.78% | 0.46% | NA |
| Aus | 269 | 12.60% | 0.00% | 2.97% | 84.39% | NA |
| Indica I | 595 | 39.70% | 0.00% | 1.85% | 58.49% | NA |
| Indica II | 465 | 12.90% | 0.40% | 3.66% | 83.01% | NA |
| Indica III | 913 | 17.60% | 0.00% | 1.31% | 81.05% | NA |
| Indica Intermediate | 786 | 25.70% | 0.10% | 2.04% | 72.14% | NA |
| Temperate Japonica | 767 | 69.10% | 25.90% | 4.82% | 0.13% | NA |
| Tropical Japonica | 504 | 95.00% | 4.00% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 78.40% | 19.10% | 1.66% | 0.83% | NA |
| VI/Aromatic | 96 | 88.50% | 1.00% | 1.04% | 9.38% | NA |
| Intermediate | 90 | 61.10% | 7.80% | 0.00% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922468532 | A -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922468532 | A -> T | LOC_Os09g39140.1 | upstream_gene_variant ; 1829.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922468532 | A -> T | LOC_Os09g39150.1 | upstream_gene_variant ; 2446.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922468532 | A -> T | LOC_Os09g39140-LOC_Os09g39150 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922468532 | NA | 5.42E-13 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0922468532 | NA | 1.54E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0922468532 | NA | 1.13E-07 | mr1045 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922468532 | NA | 3.26E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922468532 | 2.19E-07 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |