Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921541460:

Variant ID: vg0921541460 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 21541460
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:

AGATAAATGGATAAGAAGTGACAAAACTAATGGTAGCGAAACATGGCACGGAGGGAAAGTAGAACTCATAAGCTACTGTAATTATGTGATGGCTGATGAA[A/C]
ATCTTACTTAAGGCCAGGCACATCAACAATTCCAAGCCCATTGCTGTTCTTGAAAGGAAATAAAGAAGCAAAAGTAGGAAGAGCCTGTGATTTAATAGAA

Reverse complement sequence

TTCTATTAAATCACAGGCTCTTCCTACTTTTGCTTCTTTATTTCCTTTCAAGAACAGCAATGGGCTTGGAATTGTTGATGTGCCTGGCCTTAAGTAAGAT[T/G]
TTCATCAGCCATCACATAATTACAGTAGCTTATGAGTTCTACTTTCCCTCCGTGCCATGTTTCGCTACCATTAGTTTTGTCACTTCTTATCCATTTATCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.50%	14.40%	0.15%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.04%	0.00%	NA
All Japonica	1512	57.10%	42.50%	0.40%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.40%	0.13%	0.00%	NA
Temperate Japonica	767	29.20%	70.30%	0.52%	0.00%	NA
Tropical Japonica	504	93.50%	6.50%	0.00%	0.00%	NA
Japonica Intermediate	241	69.70%	29.50%	0.83%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0921541460	A -> C	LOC_Os09g37280.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:38.833; most accessible tissue: Callus, score: 87.626	N	N	N	N
vg0921541460	A -> C	LOC_Os09g37280.2	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:38.833; most accessible tissue: Callus, score: 87.626	N	N	N	N
vg0921541460	A -> C	LOC_Os09g37290.1	downstream_gene_variant ; 2414.0bp to feature; MODIFIER	silent_mutation	Average:38.833; most accessible tissue: Callus, score: 87.626	N	N	N	N
vg0921541460	A -> C	LOC_Os09g37300.1	downstream_gene_variant ; 2888.0bp to feature; MODIFIER	silent_mutation	Average:38.833; most accessible tissue: Callus, score: 87.626	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0921541460	NA	6.10E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0921541460	4.40E-07	NA	mr1008_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460	NA	4.64E-09	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460	NA	2.36E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460	NA	1.03E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460	NA	3.52E-08	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460	5.27E-06	NA	mr1406_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460	5.76E-06	NA	mr1670_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460	NA	3.33E-11	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460	NA	5.38E-06	mr1819_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460	NA	4.31E-14	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460	NA	4.34E-08	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460	NA	3.25E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460	NA	6.22E-06	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251