\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921541460:

Variant ID: vg0921541460 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21541460
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


AGATAAATGGATAAGAAGTGACAAAACTAATGGTAGCGAAACATGGCACGGAGGGAAAGTAGAACTCATAAGCTACTGTAATTATGTGATGGCTGATGAA[A/C]
ATCTTACTTAAGGCCAGGCACATCAACAATTCCAAGCCCATTGCTGTTCTTGAAAGGAAATAAAGAAGCAAAAGTAGGAAGAGCCTGTGATTTAATAGAA

Reverse complement sequence

TTCTATTAAATCACAGGCTCTTCCTACTTTTGCTTCTTTATTTCCTTTCAAGAACAGCAATGGGCTTGGAATTGTTGATGTGCCTGGCCTTAAGTAAGAT[T/G]
TTCATCAGCCATCACATAATTACAGTAGCTTATGAGTTCTACTTTCCCTCCGTGCCATGTTTCGCTACCATTAGTTTTGTCACTTCTTATCCATTTATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 14.40% 0.15% 0.00% NA
All Indica  2759 99.60% 0.40% 0.04% 0.00% NA
All Japonica  1512 57.10% 42.50% 0.40% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 29.20% 70.30% 0.52% 0.00% NA
Tropical Japonica  504 93.50% 6.50% 0.00% 0.00% NA
Japonica Intermediate  241 69.70% 29.50% 0.83% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921541460 A -> C LOC_Os09g37280.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:38.833; most accessible tissue: Callus, score: 87.626 N N N N
vg0921541460 A -> C LOC_Os09g37280.2 splice_region_variant&intron_variant ; LOW silent_mutation Average:38.833; most accessible tissue: Callus, score: 87.626 N N N N
vg0921541460 A -> C LOC_Os09g37290.1 downstream_gene_variant ; 2414.0bp to feature; MODIFIER silent_mutation Average:38.833; most accessible tissue: Callus, score: 87.626 N N N N
vg0921541460 A -> C LOC_Os09g37300.1 downstream_gene_variant ; 2888.0bp to feature; MODIFIER silent_mutation Average:38.833; most accessible tissue: Callus, score: 87.626 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921541460 NA 6.10E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0921541460 4.40E-07 NA mr1008_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460 NA 4.64E-09 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460 NA 2.36E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460 NA 1.03E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460 NA 3.52E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460 5.27E-06 NA mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460 5.76E-06 NA mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460 NA 3.33E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460 NA 5.38E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460 NA 4.31E-14 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460 NA 4.34E-08 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460 NA 3.25E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921541460 NA 6.22E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251