Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920389319:

Variant ID: vg0920389319 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20389319
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

ACGTTTCGACATGGCTCGGAATTAAGTTTCAATTGAAATTTCGAAGGTTAAACAATAGATTTGGTCGAAATTCAGTCGAAATTTATGGAAAACCGTGATA[A/C]
CGATGGGGCTCAAAATTTAGTGGTCAACCAGTAATGTTAACCCTAGCCCAAAGCCTATTAGGTACTTCTTCCCTAATTAGAGTCCAAAAGCTGATAAGGC

Reverse complement sequence

GCCTTATCAGCTTTTGGACTCTAATTAGGGAAGAAGTACCTAATAGGCTTTGGGCTAGGGTTAACATTACTGGTTGACCACTAAATTTTGAGCCCCATCG[T/G]
TATCACGGTTTTCCATAAATTTCGACTGAATTTCGACCAAATCTATTGTTTAACCTTCGAAATTTCAATTGAAACTTAATTCCGAGCCATGTCGAAACGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.00%	9.40%	2.58%	0.00%	NA
All Indica	2759	96.80%	2.80%	0.40%	0.00%	NA
All Japonica	1512	69.60%	23.30%	7.14%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.30%	4.50%	0.17%	0.00%	NA
Indica II	465	96.10%	3.70%	0.22%	0.00%	NA
Indica III	913	98.90%	0.80%	0.33%	0.00%	NA
Indica Intermediate	786	95.80%	3.40%	0.76%	0.00%	NA
Temperate Japonica	767	53.60%	37.30%	9.13%	0.00%	NA
Tropical Japonica	504	93.80%	2.40%	3.77%	0.00%	NA
Japonica Intermediate	241	69.70%	22.40%	7.88%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	91.10%	5.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920389319	A -> C	LOC_Os09g34990.1	upstream_gene_variant ; 1549.0bp to feature; MODIFIER	silent_mutation	Average:50.39; most accessible tissue: Zhenshan97 flag leaf, score: 79.247	N	N	N	N
vg0920389319	A -> C	LOC_Os09g35000.1	upstream_gene_variant ; 600.0bp to feature; MODIFIER	silent_mutation	Average:50.39; most accessible tissue: Zhenshan97 flag leaf, score: 79.247	N	N	N	N
vg0920389319	A -> C	LOC_Os09g34990-LOC_Os09g35000	intergenic_region ; MODIFIER	silent_mutation	Average:50.39; most accessible tissue: Zhenshan97 flag leaf, score: 79.247	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920389319	NA	1.03E-12	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0920389319	NA	1.29E-09	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0920389319	NA	4.67E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	4.68E-06	2.32E-09	mr1043_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	NA	6.80E-08	mr1185_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	NA	3.35E-08	mr1269_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	NA	4.88E-06	mr1291_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	NA	8.41E-07	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	NA	7.30E-08	mr1479_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	NA	6.07E-10	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	NA	4.81E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	5.50E-06	NA	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	2.01E-06	2.47E-10	mr1588_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	6.78E-06	4.61E-08	mr1677_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	NA	5.61E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	NA	6.89E-07	mr1892_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920389319	NA	5.24E-07	mr1912_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251