Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918235838:

Variant ID: vg0918235838 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18235838
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CACCTCTGCTCCATCTCAGTTTCATCAGATTCTAGTTTATTTTCCAATCCAAATGCTAACTTAGGAGGAAGATGAACGAACTATGTAATTATTAAATCTG[A/T]
GCTACAAGATTTATTATCACTTAAGTTTGCAAGGATAATTATCTCCGATGTATGTGTGAATTTGTTATTGTATTAAAGTCGGCGATATCACCCATCACAC

Reverse complement sequence

GTGTGATGGGTGATATCGCCGACTTTAATACAATAACAAATTCACACATACATCGGAGATAATTATCCTTGCAAACTTAAGTGATAATAAATCTTGTAGC[T/A]
CAGATTTAATAATTACATAGTTCGTTCATCTTCCTCCTAAGTTAGCATTTGGATTGGAAAATAAACTAGAATCTGATGAAACTGAGATGGAGCAGAGGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.30% 17.10% 1.61% 0.00% NA
All Indica  2759 97.90% 1.80% 0.33% 0.00% NA
All Japonica  1512 47.10% 48.50% 4.37% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.50% 2.90% 0.67% 0.00% NA
Indica II  465 96.80% 2.80% 0.43% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.30% 0.38% 0.00% NA
Temperate Japonica  767 16.00% 76.80% 7.17% 0.00% NA
Tropical Japonica  504 91.90% 7.50% 0.60% 0.00% NA
Japonica Intermediate  241 52.30% 44.40% 3.32% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918235838 A -> T LOC_Os09g29960.1 3_prime_UTR_variant ; 174.0bp to feature; MODIFIER silent_mutation Average:92.982; most accessible tissue: Zhenshan97 flower, score: 97.352 N N N N
vg0918235838 A -> T LOC_Os09g29950.1 upstream_gene_variant ; 4896.0bp to feature; MODIFIER silent_mutation Average:92.982; most accessible tissue: Zhenshan97 flower, score: 97.352 N N N N
vg0918235838 A -> T LOC_Os09g29970.1 upstream_gene_variant ; 1862.0bp to feature; MODIFIER silent_mutation Average:92.982; most accessible tissue: Zhenshan97 flower, score: 97.352 N N N N
vg0918235838 A -> T LOC_Os09g29950.3 upstream_gene_variant ; 4896.0bp to feature; MODIFIER silent_mutation Average:92.982; most accessible tissue: Zhenshan97 flower, score: 97.352 N N N N
vg0918235838 A -> T LOC_Os09g29950.2 upstream_gene_variant ; 4896.0bp to feature; MODIFIER silent_mutation Average:92.982; most accessible tissue: Zhenshan97 flower, score: 97.352 N N N N
vg0918235838 A -> T LOC_Os09g29980.2 downstream_gene_variant ; 4966.0bp to feature; MODIFIER silent_mutation Average:92.982; most accessible tissue: Zhenshan97 flower, score: 97.352 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918235838 A T -0.01 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918235838 NA 2.47E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0918235838 NA 3.07E-13 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0918235838 NA 5.01E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0918235838 NA 1.05E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 8.10E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 4.07E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 1.76E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 9.77E-08 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 1.75E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 1.49E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 2.00E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 6.85E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 5.26E-09 mr1263_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 5.63E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 1.71E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 3.68E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 1.45E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 6.82E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 5.85E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 1.14E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 6.20E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 6.42E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918235838 NA 3.01E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251