\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0916888277:

Variant ID: vg0916888277 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 16888277
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTATAGTATACTTCGCTCCATCCCAGAATATAGCAACCTATAACTGGATGGGACATATCCTAGTACTACGAATCTGGACAGAGAAATATGTCCAATCCG[G/A]
TTTTAGATTAGTATATTCTGGGACGGAGGGAGTAGTAATTATTGTGTAACTGCTTTTTCCTCGAAATCTGTCGAATATGTCTATATCGGTATTGGAGGAT

Reverse complement sequence

ATCCTCCAATACCGATATAGACATATTCGACAGATTTCGAGGAAAAAGCAGTTACACAATAATTACTACTCCCTCCGTCCCAGAATATACTAATCTAAAA[C/T]
CGGATTGGACATATTTCTCTGTCCAGATTCGTAGTACTAGGATATGTCCCATCCAGTTATAGGTTGCTATATTCTGGGATGGAGCGAAGTATACTATAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.70% 41.60% 0.28% 11.45% NA
All Indica  2759 78.50% 21.20% 0.00% 0.29% NA
All Japonica  1512 0.50% 68.80% 0.53% 30.09% NA
Aus  269 2.60% 95.50% 0.00% 1.86% NA
Indica I  595 48.10% 51.90% 0.00% 0.00% NA
Indica II  465 91.40% 8.00% 0.00% 0.65% NA
Indica III  913 96.40% 3.60% 0.00% 0.00% NA
Indica Intermediate  786 73.30% 26.10% 0.00% 0.64% NA
Temperate Japonica  767 0.30% 94.10% 0.39% 5.22% NA
Tropical Japonica  504 0.80% 19.00% 0.99% 79.17% NA
Japonica Intermediate  241 0.80% 92.50% 0.00% 6.64% NA
VI/Aromatic  96 2.10% 36.50% 4.17% 57.29% NA
Intermediate  90 26.70% 52.20% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0916888277 G -> DEL N N silent_mutation Average:66.965; most accessible tissue: Callus, score: 89.585 N N N N
vg0916888277 G -> A LOC_Os09g27744.1 upstream_gene_variant ; 2701.0bp to feature; MODIFIER silent_mutation Average:66.965; most accessible tissue: Callus, score: 89.585 N N N N
vg0916888277 G -> A LOC_Os09g27750.1 upstream_gene_variant ; 660.0bp to feature; MODIFIER silent_mutation Average:66.965; most accessible tissue: Callus, score: 89.585 N N N N
vg0916888277 G -> A LOC_Os09g27760.1 upstream_gene_variant ; 2245.0bp to feature; MODIFIER silent_mutation Average:66.965; most accessible tissue: Callus, score: 89.585 N N N N
vg0916888277 G -> A LOC_Os09g27750-LOC_Os09g27760 intergenic_region ; MODIFIER silent_mutation Average:66.965; most accessible tissue: Callus, score: 89.585 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0916888277 NA 1.61E-16 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0916888277 NA 6.12E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 6.76E-08 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 1.00E-13 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 3.34E-11 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 2.52E-10 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 5.42E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 1.33E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 4.97E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 6.45E-06 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 3.92E-07 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 6.85E-11 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 8.32E-11 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 5.80E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 2.44E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 4.07E-15 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 2.89E-08 mr1568 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 1.54E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 6.27E-09 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 7.04E-09 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 1.94E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 5.24E-12 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 4.57E-17 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 6.70E-13 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 3.47E-09 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 2.39E-09 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 1.65E-11 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 2.81E-10 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 6.99E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 1.64E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 2.99E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 3.60E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 5.13E-11 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 1.31E-15 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 5.10E-09 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 6.49E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0916888277 NA 5.28E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251