\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912814461:

Variant ID: vg0912814461 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12814461
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAAACACCCTCTAAATTCGCTGGTCTCTTTAGGGAACGAATAGACAGTTTTGGTCTTTTGGAGATAGCAGCATATCAGATGTGAAGGGTTCACAATTCC[G/A]
ACGAAAACCGGTCGAATTCCGCGAAATTTCGATGTTTCGACACGGCTTAGAATTAAATTTCGATTGGAGTTTCGAATATTAAACAATAGATTTGGTCGAA

Reverse complement sequence

TTCGACCAAATCTATTGTTTAATATTCGAAACTCCAATCGAAATTTAATTCTAAGCCGTGTCGAAACATCGAAATTTCGCGGAATTCGACCGGTTTTCGT[C/T]
GGAATTGTGAACCCTTCACATCTGATATGCTGCTATCTCCAAAAGACCAAAACTGTCTATTCGTTCCCTAAAGAGACCAGCGAATTTAGAGGGTGTTTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.60% 34.20% 0.25% 12.89% NA
All Indica  2759 82.10% 2.70% 0.29% 14.90% NA
All Japonica  1512 6.90% 92.10% 0.00% 0.99% NA
Aus  269 32.00% 10.40% 0.74% 56.88% NA
Indica I  595 85.90% 0.50% 0.34% 13.28% NA
Indica II  465 87.10% 1.70% 0.22% 10.97% NA
Indica III  913 79.10% 3.40% 0.22% 17.31% NA
Indica Intermediate  786 79.80% 4.20% 0.38% 15.65% NA
Temperate Japonica  767 2.10% 96.60% 0.00% 1.30% NA
Tropical Japonica  504 15.70% 83.50% 0.00% 0.79% NA
Japonica Intermediate  241 3.70% 95.90% 0.00% 0.41% NA
VI/Aromatic  96 7.30% 72.90% 2.08% 17.71% NA
Intermediate  90 27.80% 57.80% 0.00% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912814461 G -> DEL N N silent_mutation Average:55.155; most accessible tissue: Callus, score: 84.236 N N N N
vg0912814461 G -> A LOC_Os09g21220.1 upstream_gene_variant ; 4450.0bp to feature; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 84.236 N N N N
vg0912814461 G -> A LOC_Os09g21230.1 upstream_gene_variant ; 2692.0bp to feature; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 84.236 N N N N
vg0912814461 G -> A LOC_Os09g21230.3 upstream_gene_variant ; 2692.0bp to feature; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 84.236 N N N N
vg0912814461 G -> A LOC_Os09g21230.2 upstream_gene_variant ; 2764.0bp to feature; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 84.236 N N N N
vg0912814461 G -> A LOC_Os09g21230.4 upstream_gene_variant ; 3726.0bp to feature; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 84.236 N N N N
vg0912814461 G -> A LOC_Os09g21230.5 upstream_gene_variant ; 3726.0bp to feature; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 84.236 N N N N
vg0912814461 G -> A LOC_Os09g21220-LOC_Os09g21230 intergenic_region ; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 84.236 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912814461 NA 9.66E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0912814461 NA 1.06E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912814461 NA 2.31E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912814461 NA 8.01E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912814461 NA 1.08E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912814461 NA 1.40E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912814461 2.36E-07 7.76E-33 mr1323_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912814461 NA 8.09E-07 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912814461 NA 7.34E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912814461 NA 4.47E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912814461 NA 8.75E-06 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912814461 NA 2.51E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251