\
| Variant ID: vg0912814461 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 12814461 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCAAACACCCTCTAAATTCGCTGGTCTCTTTAGGGAACGAATAGACAGTTTTGGTCTTTTGGAGATAGCAGCATATCAGATGTGAAGGGTTCACAATTCC[G/A]
ACGAAAACCGGTCGAATTCCGCGAAATTTCGATGTTTCGACACGGCTTAGAATTAAATTTCGATTGGAGTTTCGAATATTAAACAATAGATTTGGTCGAA
TTCGACCAAATCTATTGTTTAATATTCGAAACTCCAATCGAAATTTAATTCTAAGCCGTGTCGAAACATCGAAATTTCGCGGAATTCGACCGGTTTTCGT[C/T]
GGAATTGTGAACCCTTCACATCTGATATGCTGCTATCTCCAAAAGACCAAAACTGTCTATTCGTTCCCTAAAGAGACCAGCGAATTTAGAGGGTGTTTGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.60% | 34.20% | 0.25% | 12.89% | NA |
| All Indica | 2759 | 82.10% | 2.70% | 0.29% | 14.90% | NA |
| All Japonica | 1512 | 6.90% | 92.10% | 0.00% | 0.99% | NA |
| Aus | 269 | 32.00% | 10.40% | 0.74% | 56.88% | NA |
| Indica I | 595 | 85.90% | 0.50% | 0.34% | 13.28% | NA |
| Indica II | 465 | 87.10% | 1.70% | 0.22% | 10.97% | NA |
| Indica III | 913 | 79.10% | 3.40% | 0.22% | 17.31% | NA |
| Indica Intermediate | 786 | 79.80% | 4.20% | 0.38% | 15.65% | NA |
| Temperate Japonica | 767 | 2.10% | 96.60% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 15.70% | 83.50% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 3.70% | 95.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 7.30% | 72.90% | 2.08% | 17.71% | NA |
| Intermediate | 90 | 27.80% | 57.80% | 0.00% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0912814461 | G -> DEL | N | N | silent_mutation | Average:55.155; most accessible tissue: Callus, score: 84.236 | N | N | N | N |
| vg0912814461 | G -> A | LOC_Os09g21220.1 | upstream_gene_variant ; 4450.0bp to feature; MODIFIER | silent_mutation | Average:55.155; most accessible tissue: Callus, score: 84.236 | N | N | N | N |
| vg0912814461 | G -> A | LOC_Os09g21230.1 | upstream_gene_variant ; 2692.0bp to feature; MODIFIER | silent_mutation | Average:55.155; most accessible tissue: Callus, score: 84.236 | N | N | N | N |
| vg0912814461 | G -> A | LOC_Os09g21230.3 | upstream_gene_variant ; 2692.0bp to feature; MODIFIER | silent_mutation | Average:55.155; most accessible tissue: Callus, score: 84.236 | N | N | N | N |
| vg0912814461 | G -> A | LOC_Os09g21230.2 | upstream_gene_variant ; 2764.0bp to feature; MODIFIER | silent_mutation | Average:55.155; most accessible tissue: Callus, score: 84.236 | N | N | N | N |
| vg0912814461 | G -> A | LOC_Os09g21230.4 | upstream_gene_variant ; 3726.0bp to feature; MODIFIER | silent_mutation | Average:55.155; most accessible tissue: Callus, score: 84.236 | N | N | N | N |
| vg0912814461 | G -> A | LOC_Os09g21230.5 | upstream_gene_variant ; 3726.0bp to feature; MODIFIER | silent_mutation | Average:55.155; most accessible tissue: Callus, score: 84.236 | N | N | N | N |
| vg0912814461 | G -> A | LOC_Os09g21220-LOC_Os09g21230 | intergenic_region ; MODIFIER | silent_mutation | Average:55.155; most accessible tissue: Callus, score: 84.236 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0912814461 | NA | 9.66E-19 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0912814461 | NA | 1.06E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912814461 | NA | 2.31E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912814461 | NA | 8.01E-09 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912814461 | NA | 1.08E-06 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912814461 | NA | 1.40E-08 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912814461 | 2.36E-07 | 7.76E-33 | mr1323_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912814461 | NA | 8.09E-07 | mr1323_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912814461 | NA | 7.34E-08 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912814461 | NA | 4.47E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912814461 | NA | 8.75E-06 | mr1780_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912814461 | NA | 2.51E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |