\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907165546:

Variant ID: vg0907165546 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7165546
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.59, A: 0.40, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AAGACAAGAAATAAAGTTCTGCACGTTTTAGATTTGAATTTGGAACTCCTGACAGCATCAACTTCAAACGGACCTAGCCGCTGATCTAAAAGAAATTTCA[A/G]
GGACCATAAGTACTTGTTGGAAAGCTTATGTAGTATACTTTAAGATGGTTTTAGTCCCAAGTCAAAATTCCCACCGAACTATCAGGAATCTGCAAAACAA

Reverse complement sequence

TTGTTTTGCAGATTCCTGATAGTTCGGTGGGAATTTTGACTTGGGACTAAAACCATCTTAAAGTATACTACATAAGCTTTCCAACAAGTACTTATGGTCC[T/C]
TGAAATTTCTTTTAGATCAGCGGCTAGGTCCGTTTGAAGTTGATGCTGTCAGGAGTTCCAAATTCAAATCTAAAACGTGCAGAACTTTATTTCTTGTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 40.70% 0.19% 0.00% NA
All Indica  2759 89.20% 10.60% 0.22% 0.00% NA
All Japonica  1512 1.30% 98.60% 0.13% 0.00% NA
Aus  269 88.50% 11.50% 0.00% 0.00% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 78.00% 21.80% 0.22% 0.00% NA
Indica Intermediate  786 90.10% 9.50% 0.38% 0.00% NA
Temperate Japonica  767 0.70% 99.20% 0.13% 0.00% NA
Tropical Japonica  504 1.80% 98.00% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 61.50% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907165546 A -> G LOC_Os09g12500.1 upstream_gene_variant ; 1027.0bp to feature; MODIFIER silent_mutation Average:50.278; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg0907165546 A -> G LOC_Os09g12500.2 upstream_gene_variant ; 1027.0bp to feature; MODIFIER silent_mutation Average:50.278; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg0907165546 A -> G LOC_Os09g12490-LOC_Os09g12500 intergenic_region ; MODIFIER silent_mutation Average:50.278; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907165546 NA 1.04E-20 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0907165546 NA 1.09E-65 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907165546 NA 1.87E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907165546 NA 1.28E-40 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907165546 NA 1.25E-15 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907165546 NA 1.05E-41 mr1542 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907165546 NA 5.34E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907165546 NA 1.05E-50 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907165546 NA 2.01E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907165546 NA 9.46E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907165546 NA 4.92E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907165546 NA 2.22E-47 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907165546 NA 1.57E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907165546 NA 2.64E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251