Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828022960:

Variant ID: vg0828022960 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 28022960
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCATTAATTCTAGTTGAAGTACACTGCTGCTAGCTAGCTCCATGCTCGCTGCTCGTTCTCCACCAATTAATAATTATATATTTAGGGCTTCTTTGAATT[G/A]
CAGGATGGCCTGATAAATAGAGGAATATAAAAAAAAATATAACAGGAATGTAAGTATAAAATAAAGAATTGCAGAACACAGGAAAAGCACCGAAATTGCC

Reverse complement sequence

GGCAATTTCGGTGCTTTTCCTGTGTTCTGCAATTCTTTATTTTATACTTACATTCCTGTTATATTTTTTTTTATATTCCTCTATTTATCAGGCCATCCTG[C/T]
AATTCAAAGAAGCCCTAAATATATAATTATTAATTGGTGGAGAACGAGCAGCGAGCATGGAGCTAGCTAGCAGCAGTGTACTTCAACTAGAATTAATGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.30%	7.60%	4.23%	60.83%	NA
All Indica	2759	0.80%	0.90%	3.73%	94.49%	NA
All Japonica	1512	76.30%	20.80%	0.33%	2.58%	NA
Aus	269	0.40%	3.70%	29.37%	66.54%	NA
Indica I	595	0.50%	0.20%	0.84%	98.49%	NA
Indica II	465	0.00%	1.70%	7.53%	90.75%	NA
Indica III	913	0.10%	0.90%	3.40%	95.62%	NA
Indica Intermediate	786	2.40%	1.10%	4.07%	92.37%	NA
Temperate Japonica	767	56.70%	40.70%	0.13%	2.48%	NA
Tropical Japonica	504	97.40%	0.00%	0.20%	2.38%	NA
Japonica Intermediate	241	94.20%	1.20%	1.24%	3.32%	NA
VI/Aromatic	96	90.60%	1.00%	6.25%	2.08%	NA
Intermediate	90	31.10%	7.80%	7.78%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0828022960	G -> A	LOC_Os08g44570.1	upstream_gene_variant ; 3378.0bp to feature; MODIFIER	silent_mutation	Average:59.509; most accessible tissue: Minghui63 root, score: 80.366	N	N	N	N
vg0828022960	G -> A	LOC_Os08g44560.1	downstream_gene_variant ; 2705.0bp to feature; MODIFIER	silent_mutation	Average:59.509; most accessible tissue: Minghui63 root, score: 80.366	N	N	N	N
vg0828022960	G -> A	LOC_Os08g44560-LOC_Os08g44570	intergenic_region ; MODIFIER	silent_mutation	Average:59.509; most accessible tissue: Minghui63 root, score: 80.366	N	N	N	N
vg0828022960	G -> DEL	N	N	silent_mutation	Average:59.509; most accessible tissue: Minghui63 root, score: 80.366	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0828022960	NA	4.95E-22	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0828022960	NA	4.29E-15	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	5.60E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	1.62E-45	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	1.35E-14	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	1.30E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	2.23E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	3.79E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	1.27E-12	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	7.56E-13	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	2.63E-21	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	1.42E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	1.27E-24	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	6.00E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	3.77E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	5.75E-12	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	2.25E-09	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	3.94E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	3.94E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	9.65E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	4.22E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	1.48E-18	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	1.21E-21	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	1.39E-19	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	1.79E-24	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	2.50E-20	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	5.98E-17	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	3.84E-07	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	2.71E-19	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	6.42E-08	mr1915_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828022960	NA	3.72E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251