Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827722509:

Variant ID: vg0827722509 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 27722509
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

TATCATATGCACACAGACCCTCACGTGTACACACGTGCACACCAACTAAAAAATGTCACTAAAAAATCTAGAAAAAATTATACACATACTTTCAATTGTA[G/T]
TACACCTAGGGTTAAAATTTTAACGTCAAATTCATTATATTTTAGCCGTAACAAAAAAAAAAACAAAAAATCTGACAGTTTTAAGGTTGTAATTTTGTCA

Reverse complement sequence

TGACAAAATTACAACCTTAAAACTGTCAGATTTTTTGTTTTTTTTTTTGTTACGGCTAAAATATAATGAATTTGACGTTAAAATTTTAACCCTAGGTGTA[C/A]
TACAATTGAAAGTATGTGTATAATTTTTTCTAGATTTTTTAGTGACATTTTTTAGTTGGTGTGCACGTGTGTACACGTGAGGGTCTGTGTGCATATGATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.20%	1.40%	19.81%	44.56%	NA
All Indica	2759	0.80%	2.40%	27.08%	69.77%	NA
All Japonica	1512	97.00%	0.10%	0.86%	2.12%	NA
Aus	269	0.40%	0.00%	58.36%	41.26%	NA
Indica I	595	0.30%	0.00%	9.75%	89.92%	NA
Indica II	465	1.10%	3.40%	29.03%	66.45%	NA
Indica III	913	0.50%	3.70%	38.55%	57.17%	NA
Indica Intermediate	786	1.30%	1.90%	25.70%	71.12%	NA
Temperate Japonica	767	96.70%	0.10%	1.17%	1.96%	NA
Tropical Japonica	504	97.40%	0.00%	0.60%	1.98%	NA
Japonica Intermediate	241	96.70%	0.00%	0.41%	2.90%	NA
VI/Aromatic	96	92.70%	0.00%	5.21%	2.08%	NA
Intermediate	90	43.30%	1.10%	15.56%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0827722509	G -> T	LOC_Os08g44030.1	upstream_gene_variant ; 2241.0bp to feature; MODIFIER	silent_mutation	Average:22.422; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0827722509	G -> T	LOC_Os08g44040.1	upstream_gene_variant ; 1985.0bp to feature; MODIFIER	silent_mutation	Average:22.422; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0827722509	G -> T	LOC_Os08g44020.1	downstream_gene_variant ; 3808.0bp to feature; MODIFIER	silent_mutation	Average:22.422; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0827722509	G -> T	LOC_Os08g44020.2	downstream_gene_variant ; 3808.0bp to feature; MODIFIER	silent_mutation	Average:22.422; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0827722509	G -> T	LOC_Os08g44020.3	downstream_gene_variant ; 3808.0bp to feature; MODIFIER	silent_mutation	Average:22.422; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0827722509	G -> T	LOC_Os08g44030-LOC_Os08g44040	intergenic_region ; MODIFIER	silent_mutation	Average:22.422; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0827722509	G -> DEL	N	N	silent_mutation	Average:22.422; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0827722509	NA	7.60E-19	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0827722509	NA	1.48E-08	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	6.16E-102	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.22E-100	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.82E-72	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.36E-26	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.55E-73	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	5.61E-33	mr1081	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	4.77E-11	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.26E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.12E-25	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	4.78E-80	mr1134	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	5.87E-80	mr1135	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.53E-47	mr1152	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	2.19E-21	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.89E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	2.21E-47	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	9.25E-15	mr1218	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.36E-08	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	8.46E-29	mr1298	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.22E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	4.29E-16	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.02E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	5.24E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.11E-27	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.02E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	2.73E-89	mr1504	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.74E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	2.74E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	9.48E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	2.67E-36	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.62E-45	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.25E-39	mr1601	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	2.05E-26	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.44E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	7.87E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	5.79E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.99E-08	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.40E-34	mr1670	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	5.92E-89	mr1672	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	2.56E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	8.33E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	9.66E-60	mr1695	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	9.20E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.09E-29	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.45E-26	mr1731	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.15E-115	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	9.87E-88	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.64E-20	mr1767	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	9.07E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.38E-15	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	7.61E-23	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	2.75E-21	mr1839	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	6.05E-45	mr1873	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	6.64E-39	mr1882	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.44E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	2.29E-30	mr1922	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	4.05E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.55E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	4.45E-21	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.28E-35	mr1944	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	6.00E-10	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	9.02E-112	mr1987	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	8.17E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	2.90E-28	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.12E-18	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	4.63E-25	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	3.00E-44	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	6.26E-46	mr1591_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.57E-31	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827722509	NA	1.42E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251