\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827013973:

Variant ID: vg0827013973 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27013973
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCGGGCAAGGCCTCACGGTTGACAACTTTGAACCGATACCCTCCACGGCGATGACGTCTTGAAGGTTGGTCGATCTCGAGAGATCGAATTGTTGACGA[C/T]
GATGGTCCCGATCTCGTCGGGGGACGTACTCTGGCGGGGTTGGAGCTCCCGGGTCCGAAGTCGTCAAGTAGCTTGTTATTGGAGAATCCATCTTTTGAAA

Reverse complement sequence

TTTCAAAAGATGGATTCTCCAATAACAAGCTACTTGACGACTTCGGACCCGGGAGCTCCAACCCCGCCAGAGTACGTCCCCCGACGAGATCGGGACCATC[G/A]
TCGTCAACAATTCGATCTCTCGAGATCGACCAACCTTCAAGACGTCATCGCCGTGGAGGGTATCGGTTCAAAGTTGTCAACCGTGAGGCCTTGCCCGAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.20% 24.00% 5.04% 31.72% NA
All Indica  2759 8.20% 39.40% 6.60% 45.85% NA
All Japonica  1512 86.20% 1.70% 0.13% 11.90% NA
Aus  269 77.70% 0.00% 14.50% 7.81% NA
Indica I  595 4.50% 56.60% 3.87% 34.96% NA
Indica II  465 6.50% 47.10% 2.15% 44.30% NA
Indica III  913 9.20% 26.80% 11.17% 52.79% NA
Indica Intermediate  786 10.80% 36.30% 5.98% 46.95% NA
Temperate Japonica  767 94.50% 2.00% 0.00% 3.52% NA
Tropical Japonica  504 73.60% 1.00% 0.40% 25.00% NA
Japonica Intermediate  241 86.30% 2.50% 0.00% 11.20% NA
VI/Aromatic  96 82.30% 1.00% 8.33% 8.33% NA
Intermediate  90 40.00% 24.40% 7.78% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827013973 C -> T LOC_Os08g42710.1 upstream_gene_variant ; 2989.0bp to feature; MODIFIER silent_mutation Average:51.212; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N
vg0827013973 C -> T LOC_Os08g42700-LOC_Os08g42710 intergenic_region ; MODIFIER silent_mutation Average:51.212; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N
vg0827013973 C -> DEL N N silent_mutation Average:51.212; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827013973 NA 6.44E-19 Yield All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0827013973 NA 6.93E-06 Yield Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0827013973 NA 7.10E-12 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827013973 NA 2.28E-16 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827013973 NA 8.05E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827013973 NA 2.89E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827013973 NA 1.53E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827013973 NA 6.11E-22 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827013973 NA 1.03E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251