Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827013973:

Variant ID: vg0827013973 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 27013973
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCGGGCAAGGCCTCACGGTTGACAACTTTGAACCGATACCCTCCACGGCGATGACGTCTTGAAGGTTGGTCGATCTCGAGAGATCGAATTGTTGACGA[C/T]
GATGGTCCCGATCTCGTCGGGGGACGTACTCTGGCGGGGTTGGAGCTCCCGGGTCCGAAGTCGTCAAGTAGCTTGTTATTGGAGAATCCATCTTTTGAAA

Reverse complement sequence

TTTCAAAAGATGGATTCTCCAATAACAAGCTACTTGACGACTTCGGACCCGGGAGCTCCAACCCCGCCAGAGTACGTCCCCCGACGAGATCGGGACCATC[G/A]
TCGTCAACAATTCGATCTCTCGAGATCGACCAACCTTCAAGACGTCATCGCCGTGGAGGGTATCGGTTCAAAGTTGTCAACCGTGAGGCCTTGCCCGAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.20%	24.00%	5.04%	31.72%	NA
All Indica	2759	8.20%	39.40%	6.60%	45.85%	NA
All Japonica	1512	86.20%	1.70%	0.13%	11.90%	NA
Aus	269	77.70%	0.00%	14.50%	7.81%	NA
Indica I	595	4.50%	56.60%	3.87%	34.96%	NA
Indica II	465	6.50%	47.10%	2.15%	44.30%	NA
Indica III	913	9.20%	26.80%	11.17%	52.79%	NA
Indica Intermediate	786	10.80%	36.30%	5.98%	46.95%	NA
Temperate Japonica	767	94.50%	2.00%	0.00%	3.52%	NA
Tropical Japonica	504	73.60%	1.00%	0.40%	25.00%	NA
Japonica Intermediate	241	86.30%	2.50%	0.00%	11.20%	NA
VI/Aromatic	96	82.30%	1.00%	8.33%	8.33%	NA
Intermediate	90	40.00%	24.40%	7.78%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0827013973	C -> T	LOC_Os08g42710.1	upstream_gene_variant ; 2989.0bp to feature; MODIFIER	silent_mutation	Average:51.212; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0827013973	C -> T	LOC_Os08g42700-LOC_Os08g42710	intergenic_region ; MODIFIER	silent_mutation	Average:51.212; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0827013973	C -> DEL	N	N	silent_mutation	Average:51.212; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0827013973	NA	6.44E-19	Yield	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0827013973	NA	6.93E-06	Yield	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0827013973	NA	7.10E-12	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827013973	NA	2.28E-16	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827013973	NA	8.05E-06	mr1359_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827013973	NA	2.89E-06	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827013973	NA	1.53E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827013973	NA	6.11E-22	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827013973	NA	1.03E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251