| Variant ID: vg0827013973 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 27013973 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 38. )
ATTCGGGCAAGGCCTCACGGTTGACAACTTTGAACCGATACCCTCCACGGCGATGACGTCTTGAAGGTTGGTCGATCTCGAGAGATCGAATTGTTGACGA[C/T]
GATGGTCCCGATCTCGTCGGGGGACGTACTCTGGCGGGGTTGGAGCTCCCGGGTCCGAAGTCGTCAAGTAGCTTGTTATTGGAGAATCCATCTTTTGAAA
TTTCAAAAGATGGATTCTCCAATAACAAGCTACTTGACGACTTCGGACCCGGGAGCTCCAACCCCGCCAGAGTACGTCCCCCGACGAGATCGGGACCATC[G/A]
TCGTCAACAATTCGATCTCTCGAGATCGACCAACCTTCAAGACGTCATCGCCGTGGAGGGTATCGGTTCAAAGTTGTCAACCGTGAGGCCTTGCCCGAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.20% | 24.00% | 5.04% | 31.72% | NA |
| All Indica | 2759 | 8.20% | 39.40% | 6.60% | 45.85% | NA |
| All Japonica | 1512 | 86.20% | 1.70% | 0.13% | 11.90% | NA |
| Aus | 269 | 77.70% | 0.00% | 14.50% | 7.81% | NA |
| Indica I | 595 | 4.50% | 56.60% | 3.87% | 34.96% | NA |
| Indica II | 465 | 6.50% | 47.10% | 2.15% | 44.30% | NA |
| Indica III | 913 | 9.20% | 26.80% | 11.17% | 52.79% | NA |
| Indica Intermediate | 786 | 10.80% | 36.30% | 5.98% | 46.95% | NA |
| Temperate Japonica | 767 | 94.50% | 2.00% | 0.00% | 3.52% | NA |
| Tropical Japonica | 504 | 73.60% | 1.00% | 0.40% | 25.00% | NA |
| Japonica Intermediate | 241 | 86.30% | 2.50% | 0.00% | 11.20% | NA |
| VI/Aromatic | 96 | 82.30% | 1.00% | 8.33% | 8.33% | NA |
| Intermediate | 90 | 40.00% | 24.40% | 7.78% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0827013973 | C -> T | LOC_Os08g42710.1 | upstream_gene_variant ; 2989.0bp to feature; MODIFIER | silent_mutation | Average:51.212; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 | N | N | N | N |
| vg0827013973 | C -> T | LOC_Os08g42700-LOC_Os08g42710 | intergenic_region ; MODIFIER | silent_mutation | Average:51.212; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 | N | N | N | N |
| vg0827013973 | C -> DEL | N | N | silent_mutation | Average:51.212; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0827013973 | NA | 6.44E-19 | Yield | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0827013973 | NA | 6.93E-06 | Yield | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0827013973 | NA | 7.10E-12 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827013973 | NA | 2.28E-16 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827013973 | NA | 8.05E-06 | mr1359_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827013973 | NA | 2.89E-06 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827013973 | NA | 1.53E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827013973 | NA | 6.11E-22 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827013973 | NA | 1.03E-07 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |