Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0823911503:

Variant ID: vg0823911503 (JBrowse)	Variation Type: INDEL
Chromosome: chr08	Position: 23911503
Reference Allele: GGT	Alternative Allele: AGT,G
Primary Allele: AGT	Secondary Allele: GGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGTGCCCACCAATTTAAATGAAAATCAATGGTCAGATTTTTGCTATTTTATTAGAGTGACACATGGCGACTCGAGAGCGTTTATAGGATGCCACAAGGC[GGT/AGT,G]
TTAGGAGTGTTTGTAGGAAGTTTGATGGACTTTTAGTATATTATAGATAGATTGACTTTCATCGTAGTTCCCATAAGATACTCGCATATGAAAATGATTT

Reverse complement sequence

AAATCATTTTCATATGCGAGTATCTTATGGGAACTACGATGAAAGTCAATCTATCTATAATATACTAAAAGTCCATCAAACTTCCTACAAACACTCCTAA[ACC/ACT,C]
GCCTTGTGGCATCCTATAAACGCTCTCGAGTCGCCATGTGTCACTCTAATAAAATAGCAAAAATCTGACCATTGATTTTCATTTAAATTGGTGGGCACAT

Allele Frequencies:

Populations	Population Size	Frequency of AGT(primary allele)	Frequency of GGT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.60%	12.10%	6.12%	4.21%	NA
All Indica	2759	86.10%	2.90%	6.02%	5.04%	NA
All Japonica	1512	58.80%	31.60%	7.34%	2.25%	NA
Aus	269	87.40%	1.50%	2.23%	8.92%	NA
Indica I	595	73.10%	5.90%	14.62%	6.39%	NA
Indica II	465	92.90%	2.20%	4.09%	0.86%	NA
Indica III	913	92.70%	0.20%	0.99%	6.13%	NA
Indica Intermediate	786	84.20%	4.10%	6.49%	5.22%	NA
Temperate Japonica	767	33.20%	55.70%	10.69%	0.39%	NA
Tropical Japonica	504	90.10%	3.80%	1.79%	4.37%	NA
Japonica Intermediate	241	74.70%	13.30%	8.30%	3.73%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	12.20%	6.67%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0823911503	GGT -> G	LOC_Os08g37750.1	upstream_gene_variant ; 2078.0bp to feature; MODIFIER	N	Average:52.722; most accessible tissue: Callus, score: 70.344	N	N	N	N
vg0823911503	GGT -> G	LOC_Os08g37740-LOC_Os08g37750	intergenic_region ; MODIFIER	N	Average:52.722; most accessible tissue: Callus, score: 70.344	N	N	N	N
vg0823911503	GGT -> AGT	LOC_Os08g37750.1	upstream_gene_variant ; 2079.0bp to feature; MODIFIER	silent_mutation	Average:52.722; most accessible tissue: Callus, score: 70.344	N	N	N	N
vg0823911503	GGT -> AGT	LOC_Os08g37740-LOC_Os08g37750	intergenic_region ; MODIFIER	silent_mutation	Average:52.722; most accessible tissue: Callus, score: 70.344	N	N	N	N
vg0823911503	GGT -> DEL	N	N	silent_mutation	Average:52.722; most accessible tissue: Callus, score: 70.344	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0823911503	1.89E-08	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0823911503	NA	1.96E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0823911503	NA	5.50E-14	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0823911503	NA	3.13E-19	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0823911503	NA	4.71E-14	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0823911503	NA	5.11E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	3.73E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	9.39E-07	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	1.57E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	2.08E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	4.04E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	3.23E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	8.24E-11	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	1.08E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	1.16E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	3.89E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	9.54E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	1.00E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	1.18E-09	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	3.84E-07	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	1.37E-10	mr1570_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	4.31E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	5.93E-12	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	1.10E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	3.52E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	3.20E-11	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	1.16E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	9.16E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	3.18E-09	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	2.63E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	2.86E-14	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823911503	NA	1.09E-07	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251