Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820990102:

Variant ID: vg0820990102 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20990102
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TGCACTTGTGGCCTTGTGGGCTGTGGCCTTATGGATGTGTGGCAGTGTGAGTGATGATGTGTTCTATATCTTTTATATAATTGAGCGATTGTTGTAATTC[G/A]
GTATTTTTCAATTAAGGCTAGTTCTCCATATCCAACTAAGGCTCAGTTCAGCACCCCAGGTTCCCAACCCAAACAGTTAGCACGGAAAACGGAACGGTCT

Reverse complement sequence

AGACCGTTCCGTTTTCCGTGCTAACTGTTTGGGTTGGGAACCTGGGGTGCTGAACTGAGCCTTAGTTGGATATGGAGAACTAGCCTTAATTGAAAAATAC[C/T]
GAATTACAACAATCGCTCAATTATATAAAAGATATAGAACACATCATCACTCACACTGCCACACATCCATAAGGCCACAGCCCACAAGGCCACAAGTGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 44.40% 0.04% 0.00% NA
All Indica  2759 90.50% 9.50% 0.00% 0.00% NA
All Japonica  1512 1.40% 98.60% 0.00% 0.00% NA
Aus  269 24.90% 74.70% 0.37% 0.00% NA
Indica I  595 85.20% 14.80% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 91.50% 8.50% 0.00% 0.00% NA
Indica Intermediate  786 89.60% 10.40% 0.00% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 1.80% 98.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 32.20% 66.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820990102 G -> A LOC_Os08g33610.1 upstream_gene_variant ; 4471.0bp to feature; MODIFIER silent_mutation Average:56.835; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0820990102 G -> A LOC_Os08g33610-LOC_Os08g33620 intergenic_region ; MODIFIER silent_mutation Average:56.835; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820990102 NA 5.48E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0820990102 NA 2.36E-29 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 7.95E-10 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 9.01E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 2.40E-48 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 2.28E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 4.93E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 2.65E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 1.98E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 2.23E-28 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 1.31E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 5.17E-15 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 2.82E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 1.36E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 1.69E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 1.51E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 1.57E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 6.54E-24 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 1.31E-13 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 1.94E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 4.13E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 3.78E-43 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 1.24E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 8.39E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 1.78E-59 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 1.49E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 4.77E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 4.48E-12 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 3.50E-06 3.50E-06 mr1781_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 2.06E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 2.44E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 1.88E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 4.21E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 3.67E-23 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 8.32E-22 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820990102 NA 2.72E-11 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251