\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819497108:

Variant ID: vg0819497108 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19497108
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


ATGATTGGTAGAGAAGAGAGATGATGTATTTATTAATGACCCACTTTAAAAAACCATGGGTTGTAGAGTGTAGTTTCTATTGTGATGTCTTATTGATATG[A/G]
CACCATAGACACTACTTATGGACACCGTGGGTTGGGACTGCCCTAAGGAGAATCACATGAGTGGGGCCCACCCCTGAGCTGGGCGACATCGACTGGTGGA

Reverse complement sequence

TCCACCAGTCGATGTCGCCCAGCTCAGGGGTGGGCCCCACTCATGTGATTCTCCTTAGGGCAGTCCCAACCCACGGTGTCCATAAGTAGTGTCTATGGTG[T/C]
CATATCAATAAGACATCACAATAGAAACTACACTCTACAACCCATGGTTTTTTAAAGTGGGTCATTAATAAATACATCATCTCTCTTCTCTACCAATCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 41.00% 0.15% 0.00% NA
All Indica  2759 55.30% 44.50% 0.18% 0.00% NA
All Japonica  1512 73.20% 26.70% 0.07% 0.00% NA
Aus  269 19.70% 80.30% 0.00% 0.00% NA
Indica I  595 76.50% 23.50% 0.00% 0.00% NA
Indica II  465 83.70% 16.30% 0.00% 0.00% NA
Indica III  913 35.70% 64.30% 0.00% 0.00% NA
Indica Intermediate  786 45.30% 54.10% 0.64% 0.00% NA
Temperate Japonica  767 92.60% 7.40% 0.00% 0.00% NA
Tropical Japonica  504 52.00% 47.80% 0.20% 0.00% NA
Japonica Intermediate  241 56.00% 44.00% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819497108 A -> G LOC_Os08g31520.1 upstream_gene_variant ; 4016.0bp to feature; MODIFIER silent_mutation Average:98.434; most accessible tissue: Minghui63 young leaf, score: 99.615 N N N N
vg0819497108 A -> G LOC_Os08g31520-LOC_Os08g31540 intergenic_region ; MODIFIER silent_mutation Average:98.434; most accessible tissue: Minghui63 young leaf, score: 99.615 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0819497108 A G -0.03 0.05 0.05 -0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819497108 NA 8.05E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819497108 NA 5.38E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819497108 NA 5.57E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819497108 NA 8.63E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819497108 NA 6.18E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819497108 NA 6.24E-06 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819497108 NA 5.30E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819497108 NA 2.52E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819497108 NA 7.07E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819497108 NA 1.95E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819497108 NA 8.05E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819497108 NA 1.36E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819497108 NA 3.56E-08 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819497108 2.57E-06 2.57E-06 mr1972_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251