Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818941914:

Variant ID: vg0818941914 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18941914
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

GGTCCTCGTCATTGACCGCGGTTGACTTCGATCACCTGCACACACGTAAACCAAACATCCGATTCTAGGCACAGTTATCGCAACCTGACCCACGTTAGTC[G/A]
TAAGCACTGACGCCTAAAATCGCCAATAATCCAAACCAAATTTCTCACTCAAAACCAACTCATGGTTAAATATTTCGTTGCCAATTTTCCATCACAAATA

Reverse complement sequence

TATTTGTGATGGAAAATTGGCAACGAAATATTTAACCATGAGTTGGTTTTGAGTGAGAAATTTGGTTTGGATTATTGGCGATTTTAGGCGTCAGTGCTTA[C/T]
GACTAACGTGGGTCAGGTTGCGATAACTGTGCCTAGAATCGGATGTTTGGTTTACGTGTGTGCAGGTGATCGAAGTCAACCGCGGTCAATGACGAGGACC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.50%	12.30%	4.08%	1.12%	NA
All Indica	2759	97.90%	1.20%	0.80%	0.04%	NA
All Japonica	1512	50.20%	35.60%	10.71%	3.44%	NA
Aus	269	98.10%	0.40%	1.49%	0.00%	NA
Indica I	595	94.30%	4.00%	1.68%	0.00%	NA
Indica II	465	98.50%	1.10%	0.43%	0.00%	NA
Indica III	913	99.70%	0.10%	0.11%	0.11%	NA
Indica Intermediate	786	98.30%	0.50%	1.15%	0.00%	NA
Temperate Japonica	767	29.30%	61.50%	9.13%	0.00%	NA
Tropical Japonica	504	75.00%	2.20%	13.49%	9.33%	NA
Japonica Intermediate	241	64.70%	23.20%	9.96%	2.07%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	87.80%	6.70%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818941914	G -> A	LOC_Os08g30710.1	upstream_gene_variant ; 480.0bp to feature; MODIFIER	silent_mutation	Average:52.644; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0818941914	G -> A	LOC_Os08g30710-LOC_Os08g30719	intergenic_region ; MODIFIER	silent_mutation	Average:52.644; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0818941914	G -> DEL	N	N	silent_mutation	Average:52.644; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818941914	NA	9.55E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818941914	NA	5.81E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818941914	NA	1.28E-15	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818941914	NA	2.95E-09	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	9.04E-08	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	8.42E-07	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	1.73E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	4.41E-08	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	3.56E-15	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	4.27E-12	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	4.56E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	8.58E-11	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	3.64E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	3.20E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	5.35E-16	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	1.67E-08	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	1.07E-06	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	2.65E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	2.72E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	1.09E-08	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	1.23E-09	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	2.02E-12	mr1794_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	5.38E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	3.40E-06	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	4.37E-06	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	5.29E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914	NA	3.92E-11	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251