Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0818941914:

Variant ID: vg0818941914 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18941914
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GGTCCTCGTCATTGACCGCGGTTGACTTCGATCACCTGCACACACGTAAACCAAACATCCGATTCTAGGCACAGTTATCGCAACCTGACCCACGTTAGTC[G/A]
TAAGCACTGACGCCTAAAATCGCCAATAATCCAAACCAAATTTCTCACTCAAAACCAACTCATGGTTAAATATTTCGTTGCCAATTTTCCATCACAAATA

Reverse complement sequence

TATTTGTGATGGAAAATTGGCAACGAAATATTTAACCATGAGTTGGTTTTGAGTGAGAAATTTGGTTTGGATTATTGGCGATTTTAGGCGTCAGTGCTTA[C/T]
GACTAACGTGGGTCAGGTTGCGATAACTGTGCCTAGAATCGGATGTTTGGTTTACGTGTGTGCAGGTGATCGAAGTCAACCGCGGTCAATGACGAGGACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 12.30% 4.08% 1.12% NA
All Indica  2759 97.90% 1.20% 0.80% 0.04% NA
All Japonica  1512 50.20% 35.60% 10.71% 3.44% NA
Aus  269 98.10% 0.40% 1.49% 0.00% NA
Indica I  595 94.30% 4.00% 1.68% 0.00% NA
Indica II  465 98.50% 1.10% 0.43% 0.00% NA
Indica III  913 99.70% 0.10% 0.11% 0.11% NA
Indica Intermediate  786 98.30% 0.50% 1.15% 0.00% NA
Temperate Japonica  767 29.30% 61.50% 9.13% 0.00% NA
Tropical Japonica  504 75.00% 2.20% 13.49% 9.33% NA
Japonica Intermediate  241 64.70% 23.20% 9.96% 2.07% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 87.80% 6.70% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818941914 G -> A LOC_Os08g30710.1 upstream_gene_variant ; 480.0bp to feature; MODIFIER silent_mutation Average:52.644; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0818941914 G -> A LOC_Os08g30710-LOC_Os08g30719 intergenic_region ; MODIFIER silent_mutation Average:52.644; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0818941914 G -> DEL N N silent_mutation Average:52.644; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818941914 NA 9.55E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818941914 NA 5.81E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818941914 NA 1.28E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818941914 NA 2.95E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 9.04E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 8.42E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 1.73E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 4.41E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 3.56E-15 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 4.27E-12 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 4.56E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 8.58E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 3.64E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 3.20E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 5.35E-16 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 1.67E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 1.07E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 2.65E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 2.72E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 1.09E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 1.23E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 2.02E-12 mr1794_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 5.38E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 3.40E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 4.37E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 5.29E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818941914 NA 3.92E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251