\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818632230:

Variant ID: vg0818632230 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18632230
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CAATTATCATCATCAGAAATCGAAGATTTTAATCTATCAATTTCAGCATTTAGAATCTCAATAGTGTGATCCTTCTCATCAAGCACAATAGAACATGTTT[A/G]
AAGTTTCTTAGCAAATTTGTAAGCAGCATATTCCAATTCATTATAACTAAGCTTTTCTTCACTATCAGATTCATCAACATCAGAATTTGCATTACGAGCA

Reverse complement sequence

TGCTCGTAATGCAAATTCTGATGTTGATGAATCTGATAGTGAAGAAAAGCTTAGTTATAATGAATTGGAATATGCTGCTTACAAATTTGCTAAGAAACTT[T/C]
AAACATGTTCTATTGTGCTTGATGAGAAGGATCACACTATTGAGATTCTAAATGCTGAAATTGATAGATTAAAATCTTCGATTTCTGATGATGATAATTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.20% 15.00% 3.75% 5.04% NA
All Indica  2759 88.10% 5.40% 2.10% 4.42% NA
All Japonica  1512 55.60% 36.20% 6.81% 1.32% NA
Aus  269 62.80% 0.00% 1.86% 35.32% NA
Indica I  595 71.60% 12.40% 6.72% 9.24% NA
Indica II  465 91.60% 3.70% 0.65% 4.09% NA
Indica III  913 98.40% 0.10% 0.55% 0.99% NA
Indica Intermediate  786 86.60% 7.10% 1.27% 4.96% NA
Temperate Japonica  767 23.30% 64.10% 10.17% 2.35% NA
Tropical Japonica  504 98.00% 0.80% 1.19% 0.00% NA
Japonica Intermediate  241 69.70% 21.60% 7.88% 0.83% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 73.30% 14.40% 12.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818632230 A -> G LOC_Os08g30280.1 upstream_gene_variant ; 400.0bp to feature; MODIFIER silent_mutation Average:13.726; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0818632230 A -> G LOC_Os08g30290.1 downstream_gene_variant ; 696.0bp to feature; MODIFIER silent_mutation Average:13.726; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0818632230 A -> G LOC_Os08g30280-LOC_Os08g30290 intergenic_region ; MODIFIER silent_mutation Average:13.726; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg0818632230 A -> DEL N N silent_mutation Average:13.726; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818632230 NA 8.34E-13 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818632230 NA 1.35E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818632230 7.74E-06 8.35E-22 Spikelet_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818632230 9.84E-06 4.24E-15 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818632230 NA 1.38E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230 NA 1.83E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230 NA 5.85E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230 NA 3.78E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230 NA 1.02E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230 NA 2.32E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230 NA 1.98E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230 NA 9.84E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230 NA 5.33E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230 NA 2.75E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230 NA 1.21E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230 NA 2.69E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230 NA 3.18E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251