Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818632230:

Variant ID: vg0818632230 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18632230
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

CAATTATCATCATCAGAAATCGAAGATTTTAATCTATCAATTTCAGCATTTAGAATCTCAATAGTGTGATCCTTCTCATCAAGCACAATAGAACATGTTT[A/G]
AAGTTTCTTAGCAAATTTGTAAGCAGCATATTCCAATTCATTATAACTAAGCTTTTCTTCACTATCAGATTCATCAACATCAGAATTTGCATTACGAGCA

Reverse complement sequence

TGCTCGTAATGCAAATTCTGATGTTGATGAATCTGATAGTGAAGAAAAGCTTAGTTATAATGAATTGGAATATGCTGCTTACAAATTTGCTAAGAAACTT[T/C]
AAACATGTTCTATTGTGCTTGATGAGAAGGATCACACTATTGAGATTCTAAATGCTGAAATTGATAGATTAAAATCTTCGATTTCTGATGATGATAATTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.20%	15.00%	3.75%	5.04%	NA
All Indica	2759	88.10%	5.40%	2.10%	4.42%	NA
All Japonica	1512	55.60%	36.20%	6.81%	1.32%	NA
Aus	269	62.80%	0.00%	1.86%	35.32%	NA
Indica I	595	71.60%	12.40%	6.72%	9.24%	NA
Indica II	465	91.60%	3.70%	0.65%	4.09%	NA
Indica III	913	98.40%	0.10%	0.55%	0.99%	NA
Indica Intermediate	786	86.60%	7.10%	1.27%	4.96%	NA
Temperate Japonica	767	23.30%	64.10%	10.17%	2.35%	NA
Tropical Japonica	504	98.00%	0.80%	1.19%	0.00%	NA
Japonica Intermediate	241	69.70%	21.60%	7.88%	0.83%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	73.30%	14.40%	12.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818632230	A -> G	LOC_Os08g30280.1	upstream_gene_variant ; 400.0bp to feature; MODIFIER	silent_mutation	Average:13.726; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg0818632230	A -> G	LOC_Os08g30290.1	downstream_gene_variant ; 696.0bp to feature; MODIFIER	silent_mutation	Average:13.726; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg0818632230	A -> G	LOC_Os08g30280-LOC_Os08g30290	intergenic_region ; MODIFIER	silent_mutation	Average:13.726; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg0818632230	A -> DEL	N	N	silent_mutation	Average:13.726; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818632230	NA	8.34E-13	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818632230	NA	1.35E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818632230	7.74E-06	8.35E-22	Spikelet_length	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818632230	9.84E-06	4.24E-15	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0818632230	NA	1.38E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230	NA	1.83E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230	NA	5.85E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230	NA	3.78E-07	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230	NA	1.02E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230	NA	2.32E-08	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230	NA	1.98E-08	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230	NA	9.84E-08	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230	NA	5.33E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230	NA	2.75E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230	NA	1.21E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230	NA	2.69E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818632230	NA	3.18E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251