\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817677081:

Variant ID: vg0817677081 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17677081
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TCTAGTATTCACATGAACTGTGTGCATTTGCCTAGAATTTGTTTTTCCAAATCAATGTACATCTGACACTTTGTCCGGTGACTGGATCCTATAACCCGGT[G/T]
CGGTTATCTCATATGAAAACGTGTCGATATGCTCAAGACTTGGGAAGACGCCATTGATCACCATCGTTCTCGACTGAAAGCATGTTCCCAATGGTTTATT

Reverse complement sequence

AATAAACCATTGGGAACATGCTTTCAGTCGAGAACGATGGTGATCAATGGCGTCTTCCCAAGTCTTGAGCATATCGACACGTTTTCATATGAGATAACCG[C/A]
ACCGGGTTATAGGATCCAGTCACCGGACAAAGTGTCAGATGTACATTGATTTGGAAAAACAAATTCTAGGCAAATGCACACAGTTCATGTGAATACTAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 38.40% 0.25% 0.17% NA
All Indica  2759 43.60% 55.90% 0.29% 0.29% NA
All Japonica  1512 84.00% 15.80% 0.20% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 75.60% 23.90% 0.17% 0.34% NA
Indica II  465 12.00% 88.00% 0.00% 0.00% NA
Indica III  913 37.50% 62.00% 0.33% 0.22% NA
Indica Intermediate  786 45.00% 53.90% 0.51% 0.51% NA
Temperate Japonica  767 97.80% 2.20% 0.00% 0.00% NA
Tropical Japonica  504 64.30% 35.30% 0.40% 0.00% NA
Japonica Intermediate  241 81.30% 18.30% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817677081 G -> T LOC_Os08g28900.1 upstream_gene_variant ; 829.0bp to feature; MODIFIER silent_mutation Average:49.075; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0817677081 G -> T LOC_Os08g28890.1 downstream_gene_variant ; 2697.0bp to feature; MODIFIER silent_mutation Average:49.075; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0817677081 G -> T LOC_Os08g28890-LOC_Os08g28900 intergenic_region ; MODIFIER silent_mutation Average:49.075; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0817677081 G -> DEL N N silent_mutation Average:49.075; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817677081 NA 5.10E-17 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0817677081 NA 2.70E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817677081 1.03E-06 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817677081 NA 1.13E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817677081 NA 1.49E-06 mr1836 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817677081 1.80E-08 NA mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817677081 NA 7.39E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817677081 NA 8.68E-11 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817677081 NA 6.71E-10 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817677081 NA 1.73E-06 mr1362_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817677081 1.60E-06 NA mr1533_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817677081 NA 4.10E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817677081 NA 4.58E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817677081 NA 6.12E-06 mr1836_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251