Variant ID: vg0817676420 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 17676420 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 213. )
GCATTCACGTGACACTAAACATCATGTTACGTGGTATGTGAGAGTTGCAGTATGTATGTGTTGGGCTTTTTGTTGTACAAAATATGGTCACGATGAAGAT[A/G]
TTACACTCATACTATAAATGGCTTAATATATATTGCAAACTTTACATCTTCGTGAGTCACGGTTTATGGTTGTCGCCGCCATAACGCCATTGCAAGTCCC
GGGACTTGCAATGGCGTTATGGCGGCGACAACCATAAACCGTGACTCACGAAGATGTAAAGTTTGCAATATATATTAAGCCATTTATAGTATGAGTGTAA[T/C]
ATCTTCATCGTGACCATATTTTGTACAACAAAAAGCCCAACACATACATACTGCAACTCTCACATACCACGTAACATGATGTTTAGTGTCACGTGAATGC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 60.40% | 39.10% | 0.25% | 0.23% | NA |
All Indica | 2759 | 42.70% | 56.70% | 0.33% | 0.36% | NA |
All Japonica | 1512 | 83.40% | 16.40% | 0.20% | 0.00% | NA |
Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 74.50% | 25.00% | 0.17% | 0.34% | NA |
Indica II | 465 | 12.00% | 87.70% | 0.22% | 0.00% | NA |
Indica III | 913 | 35.80% | 63.50% | 0.33% | 0.33% | NA |
Indica Intermediate | 786 | 44.70% | 54.20% | 0.51% | 0.64% | NA |
Temperate Japonica | 767 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 64.10% | 35.50% | 0.40% | 0.00% | NA |
Japonica Intermediate | 241 | 80.50% | 19.10% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 62.20% | 36.70% | 0.00% | 1.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0817676420 | A -> G | LOC_Os08g28900.1 | upstream_gene_variant ; 1490.0bp to feature; MODIFIER | silent_mutation | Average:53.29; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
vg0817676420 | A -> G | LOC_Os08g28890.1 | downstream_gene_variant ; 2036.0bp to feature; MODIFIER | silent_mutation | Average:53.29; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
vg0817676420 | A -> G | LOC_Os08g28890-LOC_Os08g28900 | intergenic_region ; MODIFIER | silent_mutation | Average:53.29; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
vg0817676420 | A -> DEL | N | N | silent_mutation | Average:53.29; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0817676420 | NA | 1.79E-16 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0817676420 | NA | 2.70E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0817676420 | NA | 8.79E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0817676420 | 1.59E-07 | NA | mr1533 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0817676420 | NA | 1.13E-08 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0817676420 | NA | 1.49E-06 | mr1836 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0817676420 | 1.05E-08 | NA | mr1980 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0817676420 | NA | 5.04E-06 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0817676420 | NA | 8.68E-11 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0817676420 | NA | 2.64E-09 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/