Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815890904:

Variant ID: vg0815890904 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15890904
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTGAGAAAAGCTACAGCTGGGACAAGCTCCCTCAAACAGGACCTAAACTCTGAACGACCGTTGAATTGGGCTGCATGGATTTTCGTTAATAGGCTGGT[G/C]
ACTGACAAGGCTTTTTTTTTTTTTTTTTGCTCCCGCTAAGCCCATAAAGTCCAGGGCCCAGAGAGCAGTACATTCTCTTAGCCGATGTTGGCATAGGCCA

Reverse complement sequence

TGGCCTATGCCAACATCGGCTAAGAGAATGTACTGCTCTCTGGGCCCTGGACTTTATGGGCTTAGCGGGAGCAAAAAAAAAAAAAAAAAGCCTTGTCAGT[C/G]
ACCAGCCTATTAACGAAAATCCATGCAGCCCAATTCAACGGTCGTTCAGAGTTTAGGTCCTGTTTGAGGGAGCTTGTCCCAGCTGTAGCTTTTCTCAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.50% 11.90% 0.91% 0.68% NA
All Indica  2759 97.30% 1.20% 0.72% 0.80% NA
All Japonica  1512 64.00% 34.20% 1.19% 0.60% NA
Aus  269 98.50% 0.40% 0.74% 0.37% NA
Indica I  595 95.10% 3.20% 0.84% 0.84% NA
Indica II  465 97.00% 1.30% 1.08% 0.65% NA
Indica III  913 98.10% 0.10% 0.66% 1.10% NA
Indica Intermediate  786 98.20% 0.80% 0.51% 0.51% NA
Temperate Japonica  767 39.10% 59.30% 1.56% 0.00% NA
Tropical Japonica  504 98.80% 1.00% 0.00% 0.20% NA
Japonica Intermediate  241 70.50% 23.70% 2.49% 3.32% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 15.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815890904 G -> C LOC_Os08g26120.1 upstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:93.115; most accessible tissue: Zhenshan97 panicle, score: 96.599 N N N N
vg0815890904 G -> C LOC_Os08g26120-LOC_Os08g26140 intergenic_region ; MODIFIER silent_mutation Average:93.115; most accessible tissue: Zhenshan97 panicle, score: 96.599 N N N N
vg0815890904 G -> DEL N N silent_mutation Average:93.115; most accessible tissue: Zhenshan97 panicle, score: 96.599 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0815890904 G C 0.03 0.04 0.03 0.04 0.05 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815890904 NA 9.16E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0815890904 NA 2.24E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815890904 NA 4.06E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815890904 NA 1.75E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815890904 NA 3.83E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815890904 4.91E-06 4.91E-06 mr1812 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815890904 NA 5.47E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251