\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812614023:

Variant ID: vg0812614023 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12614023
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACAATCCATACCTAGTGGTAAAAGCTGTCTTAGGTATATCTTCCTCTTTGATCCTCAACTGGTGATACCCTGATCGAAGATCTATCTTGGAGAAAACG[A/G]
TGGCACCTTTAAGCTGATCAAACAAATCATCAATTCTGGGCAGCGGATACTTATTCTTGATAGTCACATCATTTAGTGCACGATAGTCTACACACATCCT

Reverse complement sequence

AGGATGTGTGTAGACTATCGTGCACTAAATGATGTGACTATCAAGAATAAGTATCCGCTGCCCAGAATTGATGATTTGTTTGATCAGCTTAAAGGTGCCA[T/C]
CGTTTTCTCCAAGATAGATCTTCGATCAGGGTATCACCAGTTGAGGATCAAAGAGGAAGATATACCTAAGACAGCTTTTACCACTAGGTATGGATTGTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 23.90% 8.23% 9.08% NA
All Indica  2759 89.10% 3.10% 6.34% 1.52% NA
All Japonica  1512 7.00% 63.10% 10.71% 19.18% NA
Aus  269 62.10% 24.20% 11.90% 1.86% NA
Indica I  595 96.60% 1.50% 1.68% 0.17% NA
Indica II  465 89.20% 4.70% 5.59% 0.43% NA
Indica III  913 86.30% 2.30% 8.21% 3.18% NA
Indica Intermediate  786 86.40% 4.20% 8.14% 1.27% NA
Temperate Japonica  767 9.40% 85.80% 3.00% 1.83% NA
Tropical Japonica  504 4.20% 39.50% 22.42% 33.93% NA
Japonica Intermediate  241 5.40% 40.20% 10.79% 43.57% NA
VI/Aromatic  96 10.40% 0.00% 7.29% 82.29% NA
Intermediate  90 42.20% 28.90% 14.44% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812614023 A -> G LOC_Os08g21110.1 missense_variant ; p.Ile1259Thr; MODERATE nonsynonymous_codon ; I1259T Average:10.08; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 benign -0.365 TOLERATED 1.00
vg0812614023 A -> DEL LOC_Os08g21110.1 N frameshift_variant Average:10.08; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812614023 NA 2.95E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812614023 NA 1.13E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812614023 NA 3.22E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 6.86E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 1.65E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 7.32E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 4.46E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 1.02E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 7.73E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 3.01E-06 mr1588 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 3.41E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 2.58E-06 1.40E-06 mr1904 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 5.56E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 3.78E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 5.09E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 5.26E-09 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023 NA 1.02E-09 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251