Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812614023:

Variant ID: vg0812614023 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12614023
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAACAATCCATACCTAGTGGTAAAAGCTGTCTTAGGTATATCTTCCTCTTTGATCCTCAACTGGTGATACCCTGATCGAAGATCTATCTTGGAGAAAACG[A/G]
TGGCACCTTTAAGCTGATCAAACAAATCATCAATTCTGGGCAGCGGATACTTATTCTTGATAGTCACATCATTTAGTGCACGATAGTCTACACACATCCT

Reverse complement sequence

AGGATGTGTGTAGACTATCGTGCACTAAATGATGTGACTATCAAGAATAAGTATCCGCTGCCCAGAATTGATGATTTGTTTGATCAGCTTAAAGGTGCCA[T/C]
CGTTTTCTCCAAGATAGATCTTCGATCAGGGTATCACCAGTTGAGGATCAAAGAGGAAGATATACCTAAGACAGCTTTTACCACTAGGTATGGATTGTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	23.90%	8.23%	9.08%	NA
All Indica	2759	89.10%	3.10%	6.34%	1.52%	NA
All Japonica	1512	7.00%	63.10%	10.71%	19.18%	NA
Aus	269	62.10%	24.20%	11.90%	1.86%	NA
Indica I	595	96.60%	1.50%	1.68%	0.17%	NA
Indica II	465	89.20%	4.70%	5.59%	0.43%	NA
Indica III	913	86.30%	2.30%	8.21%	3.18%	NA
Indica Intermediate	786	86.40%	4.20%	8.14%	1.27%	NA
Temperate Japonica	767	9.40%	85.80%	3.00%	1.83%	NA
Tropical Japonica	504	4.20%	39.50%	22.42%	33.93%	NA
Japonica Intermediate	241	5.40%	40.20%	10.79%	43.57%	NA
VI/Aromatic	96	10.40%	0.00%	7.29%	82.29%	NA
Intermediate	90	42.20%	28.90%	14.44%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812614023	A -> G	LOC_Os08g21110.1	missense_variant ; p.Ile1259Thr; MODERATE	nonsynonymous_codon ; I1259T	Average:10.08; most accessible tissue: Zhenshan97 flag leaf, score: 18.298	benign	-0.365	TOLERATED	1.00
vg0812614023	A -> DEL	LOC_Os08g21110.1	N	frameshift_variant	Average:10.08; most accessible tissue: Zhenshan97 flag leaf, score: 18.298	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812614023	NA	2.95E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812614023	NA	1.13E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812614023	NA	3.22E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	6.86E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	1.65E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	7.32E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	4.46E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	1.02E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	7.73E-08	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	3.01E-06	mr1588	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	3.41E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	2.58E-06	1.40E-06	mr1904	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	5.56E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	3.78E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	5.09E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	5.26E-09	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812614023	NA	1.02E-09	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251