Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812036969:

Variant ID: vg0812036969 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12036969
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAATTGAGAGCGACACAGTAACTTCCACTTCAAACAAAAATATCAAGAATCATTGCTTAGTTCCTGGAAAACAACAGCAGCCGAAGTGGATACCTTCC[A/G]
GCTTATCTCGCTCTCAAAAGAGGAGGCTACAACGTTTTCGGGCCATAGGTCAAAAAGAAAAGGAGGCCGAAAACATAAGGGACCAAACATGTAAAGATTT

Reverse complement sequence

AAATCTTTACATGTTTGGTCCCTTATGTTTTCGGCCTCCTTTTCTTTTTGACCTATGGCCCGAAAACGTTGTAGCCTCCTCTTTTGAGAGCGAGATAAGC[T/C]
GGAAGGTATCCACTTCGGCTGCTGTTGTTTTCCAGGAACTAAGCAATGATTCTTGATATTTTTGTTTGAAGTGGAAGTTACTGTGTCGCTCTCAATTTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.00%	17.90%	0.15%	60.98%	NA
All Indica	2759	10.70%	2.10%	0.22%	86.95%	NA
All Japonica	1512	37.80%	50.70%	0.00%	11.51%	NA
Aus	269	0.70%	0.00%	0.37%	98.88%	NA
Indica I	595	2.70%	4.00%	0.34%	92.94%	NA
Indica II	465	8.40%	2.20%	0.22%	89.25%	NA
Indica III	913	17.60%	0.70%	0.11%	81.60%	NA
Indica Intermediate	786	10.20%	2.30%	0.25%	87.28%	NA
Temperate Japonica	767	10.70%	84.70%	0.00%	4.56%	NA
Tropical Japonica	504	70.80%	8.90%	0.00%	20.24%	NA
Japonica Intermediate	241	55.20%	29.50%	0.00%	15.35%	NA
VI/Aromatic	96	92.70%	1.00%	0.00%	6.25%	NA
Intermediate	90	37.80%	21.10%	0.00%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812036969	A -> G	LOC_Os08g20080.1	missense_variant ; p.Ser187Gly; MODERATE	nonsynonymous_codon ; S187G	Average:10.575; most accessible tissue: Callus, score: 46.572	unknown	unknown	TOLERATED	1.00
vg0812036969	A -> DEL	LOC_Os08g20080.1	N	frameshift_variant	Average:10.575; most accessible tissue: Callus, score: 46.572	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812036969	NA	1.02E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812036969	NA	1.76E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812036969	NA	2.58E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812036969	NA	3.43E-13	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812036969	NA	1.50E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	1.01E-06	3.07E-06	mr1727	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	1.32E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	1.41E-10	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	5.52E-06	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	6.63E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	4.99E-09	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	5.94E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	4.78E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	1.88E-11	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	1.61E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	6.73E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	3.63E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	4.17E-08	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969	NA	1.84E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251