\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812036969:

Variant ID: vg0812036969 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12036969
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAATTGAGAGCGACACAGTAACTTCCACTTCAAACAAAAATATCAAGAATCATTGCTTAGTTCCTGGAAAACAACAGCAGCCGAAGTGGATACCTTCC[A/G]
GCTTATCTCGCTCTCAAAAGAGGAGGCTACAACGTTTTCGGGCCATAGGTCAAAAAGAAAAGGAGGCCGAAAACATAAGGGACCAAACATGTAAAGATTT

Reverse complement sequence

AAATCTTTACATGTTTGGTCCCTTATGTTTTCGGCCTCCTTTTCTTTTTGACCTATGGCCCGAAAACGTTGTAGCCTCCTCTTTTGAGAGCGAGATAAGC[T/C]
GGAAGGTATCCACTTCGGCTGCTGTTGTTTTCCAGGAACTAAGCAATGATTCTTGATATTTTTGTTTGAAGTGGAAGTTACTGTGTCGCTCTCAATTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.00% 17.90% 0.15% 60.98% NA
All Indica  2759 10.70% 2.10% 0.22% 86.95% NA
All Japonica  1512 37.80% 50.70% 0.00% 11.51% NA
Aus  269 0.70% 0.00% 0.37% 98.88% NA
Indica I  595 2.70% 4.00% 0.34% 92.94% NA
Indica II  465 8.40% 2.20% 0.22% 89.25% NA
Indica III  913 17.60% 0.70% 0.11% 81.60% NA
Indica Intermediate  786 10.20% 2.30% 0.25% 87.28% NA
Temperate Japonica  767 10.70% 84.70% 0.00% 4.56% NA
Tropical Japonica  504 70.80% 8.90% 0.00% 20.24% NA
Japonica Intermediate  241 55.20% 29.50% 0.00% 15.35% NA
VI/Aromatic  96 92.70% 1.00% 0.00% 6.25% NA
Intermediate  90 37.80% 21.10% 0.00% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812036969 A -> G LOC_Os08g20080.1 missense_variant ; p.Ser187Gly; MODERATE nonsynonymous_codon ; S187G Average:10.575; most accessible tissue: Callus, score: 46.572 unknown unknown TOLERATED 1.00
vg0812036969 A -> DEL LOC_Os08g20080.1 N frameshift_variant Average:10.575; most accessible tissue: Callus, score: 46.572 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812036969 NA 1.02E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812036969 NA 1.76E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812036969 NA 2.58E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812036969 NA 3.43E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812036969 NA 1.50E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 1.01E-06 3.07E-06 mr1727 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 1.32E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 1.41E-10 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 5.52E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 6.63E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 4.99E-09 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 5.94E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 4.78E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 1.88E-11 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 1.61E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 6.73E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 3.63E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 4.17E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812036969 NA 1.84E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251