Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0810144928:

Variant ID: vg0810144928 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10144928
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.37, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTCCTGTGCTACTGTTATTTGACATCTCTATCGAACGGATAACGCGTTAGTTAGAGCAGGTACAATAGCATACTGCTAGCTATAAACAGAAGATAAAA[G/A]
ATGAGAGAGAAGACTACAGATTTATAGCCAGCTGCAGCACATACTCTAAAATACATGTGTGTATGATAGGTGAGATCGAGATATGGTGCAATTGTTACTA

Reverse complement sequence

TAGTAACAATTGCACCATATCTCGATCTCACCTATCATACACACATGTATTTTAGAGTATGTGCTGCAGCTGGCTATAAATCTGTAGTCTTCTCTCTCAT[C/T]
TTTTATCTTCTGTTTATAGCTAGCAGTATGCTATTGTACCTGCTCTAACTAACGCGTTATCCGTTCGATAGAGATGTCAAATAACAGTAGCACAGGAACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 35.60% 0.44% 1.71% NA
All Indica  2759 73.70% 25.00% 0.40% 0.94% NA
All Japonica  1512 38.70% 57.30% 0.46% 3.51% NA
Aus  269 98.50% 1.10% 0.00% 0.37% NA
Indica I  595 92.90% 6.60% 0.00% 0.50% NA
Indica II  465 50.80% 46.90% 0.86% 1.51% NA
Indica III  913 69.90% 29.00% 0.22% 0.88% NA
Indica Intermediate  786 77.10% 21.20% 0.64% 1.02% NA
Temperate Japonica  767 59.60% 32.90% 0.65% 6.91% NA
Tropical Japonica  504 13.10% 86.70% 0.20% 0.00% NA
Japonica Intermediate  241 25.70% 73.90% 0.41% 0.00% NA
VI/Aromatic  96 6.20% 92.70% 1.04% 0.00% NA
Intermediate  90 58.90% 37.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810144928 G -> A LOC_Os08g16580.1 upstream_gene_variant ; 151.0bp to feature; MODIFIER silent_mutation Average:94.627; most accessible tissue: Minghui63 flower, score: 96.715 N N N N
vg0810144928 G -> A LOC_Os08g16570.1 downstream_gene_variant ; 3203.0bp to feature; MODIFIER silent_mutation Average:94.627; most accessible tissue: Minghui63 flower, score: 96.715 N N N N
vg0810144928 G -> A LOC_Os08g16590.1 downstream_gene_variant ; 2986.0bp to feature; MODIFIER silent_mutation Average:94.627; most accessible tissue: Minghui63 flower, score: 96.715 N N N N
vg0810144928 G -> A LOC_Os08g16570.3 downstream_gene_variant ; 3203.0bp to feature; MODIFIER silent_mutation Average:94.627; most accessible tissue: Minghui63 flower, score: 96.715 N N N N
vg0810144928 G -> A LOC_Os08g16580-LOC_Os08g16590 intergenic_region ; MODIFIER silent_mutation Average:94.627; most accessible tissue: Minghui63 flower, score: 96.715 N N N N
vg0810144928 G -> DEL N N silent_mutation Average:94.627; most accessible tissue: Minghui63 flower, score: 96.715 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0810144928 G A 0.07 0.08 0.12 -0.05 -0.01 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810144928 NA 3.06E-17 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0810144928 NA 2.31E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 2.45E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 7.17E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 5.30E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 1.49E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 3.71E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 8.30E-08 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 1.50E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 1.78E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 2.10E-10 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 8.13E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 2.23E-06 4.26E-11 mr1057_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 4.76E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 4.24E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 2.22E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 7.55E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 6.84E-07 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810144928 NA 1.21E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251