Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809531576:

Variant ID: vg0809531576 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9531576
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGGGGAGGAAAGTGGATACAGATGGCATGTGGACCCTACAGATTTTTCCCTTGAGAGGCTTACATGTGAGCCAGACATGTGGGTTCCACTTGCTAACT[C/T]
AGCGGGTTAGCTACGGTCAACTTGCCACGTCAATAGAAACTGCTTTTATTCATTTGCCCTTGTTTTCGAAAATGGGAGACCGATTTTGTGGTTGAGGAAG

Reverse complement sequence

CTTCCTCAACCACAAAATCGGTCTCCCATTTTCGAAAACAAGGGCAAATGAATAAAAGCAGTTTCTATTGACGTGGCAAGTTGACCGTAGCTAACCCGCT[G/A]
AGTTAGCAAGTGGAACCCACATGTCTGGCTCACATGTAAGCCTCTCAAGGGAAAAATCTGTAGGGTCCACATGCCATCTGTATCCACTTTCCTCCCCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 45.10% 0.17% 5.42% NA
All Indica  2759 52.40% 46.80% 0.11% 0.65% NA
All Japonica  1512 38.20% 46.00% 0.33% 15.41% NA
Aus  269 98.50% 1.10% 0.00% 0.37% NA
Indica I  595 53.80% 45.70% 0.17% 0.34% NA
Indica II  465 57.20% 41.90% 0.22% 0.65% NA
Indica III  913 53.60% 45.90% 0.11% 0.44% NA
Indica Intermediate  786 47.30% 51.50% 0.00% 1.15% NA
Temperate Japonica  767 67.00% 8.50% 0.39% 24.12% NA
Tropical Japonica  504 1.60% 92.10% 0.00% 6.35% NA
Japonica Intermediate  241 23.20% 69.30% 0.83% 6.64% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 40.00% 55.60% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809531576 C -> T LOC_Os08g15690.1 downstream_gene_variant ; 4086.0bp to feature; MODIFIER silent_mutation Average:62.809; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0809531576 C -> T LOC_Os08g15700.1 downstream_gene_variant ; 738.0bp to feature; MODIFIER silent_mutation Average:62.809; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0809531576 C -> T LOC_Os08g15700-LOC_Os08g15710 intergenic_region ; MODIFIER silent_mutation Average:62.809; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0809531576 C -> DEL N N silent_mutation Average:62.809; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0809531576 C T -0.01 -0.01 -0.01 -0.03 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809531576 NA 2.17E-13 Heading_date All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0809531576 NA 2.69E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0809531576 NA 9.68E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251