\
| Variant ID: vg0809143046 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 9143046 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACTAATTTGAGCGGGTGGATTTATGACCATCTCAAGGCAGAGAAAAAGAATAGGTGAGTAAAATCTAGCAGCAAGTGATTTCTCCAACTCTTTGATCAAA[A/C,T]
TAATAGCTTATCCTACAATATTGCTATAGATAGTGAGAAGAAACAGTTAGACAATGATAACCATGATGATATTCATGTTTATGAAGACTTGGGCCACGTA
TACGTGGCCCAAGTCTTCATAAACATGAATATCATCATGGTTATCATTGTCTAACTGTTTCTTCTCACTATCTATAGCAATATTGTAGGATAAGCTATTA[T/G,A]
TTTGATCAAAGAGTTGGAGAAATCACTTGCTGCTAGATTTTACTCACCTATTCTTTTTCTCTGCCTTGAGATGGTCATAAATCCACCCGCTCAAATTAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.70% | 11.50% | 5.71% | 0.06% | T: 0.06% |
| All Indica | 2759 | 90.80% | 1.00% | 8.05% | 0.07% | T: 0.11% |
| All Japonica | 1512 | 64.60% | 33.00% | 2.45% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.20% | 1.80% | 10.92% | 0.00% | NA |
| Indica II | 465 | 91.00% | 1.10% | 7.74% | 0.00% | T: 0.22% |
| Indica III | 913 | 93.20% | 0.30% | 6.02% | 0.22% | T: 0.22% |
| Indica Intermediate | 786 | 90.60% | 1.00% | 8.40% | 0.00% | NA |
| Temperate Japonica | 767 | 42.20% | 56.70% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 1.40% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.40% | 23.70% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 2.10% | 8.33% | 1.04% | NA |
| Intermediate | 90 | 81.10% | 15.60% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809143046 | A -> C | LOC_Os08g15090-LOC_Os08g15100 | intergenic_region ; MODIFIER | silent_mutation | Average:31.747; most accessible tissue: Callus, score: 60.666 | N | N | N | N |
| vg0809143046 | A -> T | LOC_Os08g15090-LOC_Os08g15100 | intergenic_region ; MODIFIER | silent_mutation | Average:31.747; most accessible tissue: Callus, score: 60.666 | N | N | N | N |
| vg0809143046 | A -> DEL | N | N | silent_mutation | Average:31.747; most accessible tissue: Callus, score: 60.666 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809143046 | NA | 1.89E-13 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0809143046 | NA | 2.49E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0809143046 | NA | 4.34E-15 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0809143046 | NA | 3.96E-07 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809143046 | NA | 4.69E-06 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809143046 | NA | 8.21E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809143046 | NA | 3.67E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809143046 | NA | 8.45E-06 | mr1912_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809143046 | 1.81E-08 | 1.81E-08 | mr1919_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809143046 | NA | 3.25E-07 | mr1919_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |