\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805548082:

Variant ID: vg0805548082 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5548082
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GGTATGGGGAAGAAATAGCAAGACTGAGTATTACCCACTGTATTCAGCAAGTCATACCGGAAAAGGAGTTGGGCCAAGAATGCAGAAATGAGGAGTTTGA[G/A]
AAAAGGGAGTGGTTGGCTATCTCAATGGGGTCGGGCCCTCGAGATGGGTGAGACACAAGAGATTTAGATAGATTCGGGCCGCTAAAGAGTGTAGTACCCT

Reverse complement sequence

AGGGTACTACACTCTTTAGCGGCCCGAATCTATCTAAATCTCTTGTGTCTCACCCATCTCGAGGGCCCGACCCCATTGAGATAGCCAACCACTCCCTTTT[C/T]
TCAAACTCCTCATTTCTGCATTCTTGGCCCAACTCCTTTTCCGGTATGACTTGCTGAATACAGTGGGTAATACTCAGTCTTGCTATTTCTTCCCCATACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.80% 18.40% 5.21% 15.53% NA
All Indica  2759 58.30% 16.20% 6.20% 19.28% NA
All Japonica  1512 59.10% 27.80% 4.30% 8.86% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 28.20% 39.30% 13.95% 18.49% NA
Indica II  465 55.30% 9.20% 6.45% 29.03% NA
Indica III  913 79.20% 5.90% 0.33% 14.57% NA
Indica Intermediate  786 58.70% 14.80% 7.00% 19.59% NA
Temperate Japonica  767 52.40% 42.00% 3.52% 2.09% NA
Tropical Japonica  504 73.80% 5.00% 3.97% 17.26% NA
Japonica Intermediate  241 49.40% 30.30% 7.47% 12.86% NA
VI/Aromatic  96 42.70% 2.10% 3.12% 52.08% NA
Intermediate  90 72.20% 2.20% 7.78% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805548082 G -> A LOC_Os08g09590.1 upstream_gene_variant ; 3261.0bp to feature; MODIFIER silent_mutation Average:46.68; most accessible tissue: Zhenshan97 young leaf, score: 68.794 N N N N
vg0805548082 G -> A LOC_Os08g09570.1 downstream_gene_variant ; 1901.0bp to feature; MODIFIER silent_mutation Average:46.68; most accessible tissue: Zhenshan97 young leaf, score: 68.794 N N N N
vg0805548082 G -> A LOC_Os08g09580.1 downstream_gene_variant ; 1410.0bp to feature; MODIFIER silent_mutation Average:46.68; most accessible tissue: Zhenshan97 young leaf, score: 68.794 N N N N
vg0805548082 G -> A LOC_Os08g09570-LOC_Os08g09580 intergenic_region ; MODIFIER silent_mutation Average:46.68; most accessible tissue: Zhenshan97 young leaf, score: 68.794 N N N N
vg0805548082 G -> DEL N N silent_mutation Average:46.68; most accessible tissue: Zhenshan97 young leaf, score: 68.794 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805548082 NA 3.22E-17 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0805548082 NA 3.26E-06 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 3.31E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 6.95E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 2.79E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 1.66E-06 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 7.98E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 2.77E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 1.36E-06 mr1318_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 5.88E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 6.32E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 7.58E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 2.21E-08 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 8.56E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 4.40E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 2.94E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 6.78E-08 mr1788_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 2.95E-07 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 NA 1.92E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548082 9.50E-06 9.50E-06 mr1927_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251