\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804053856:

Variant ID: vg0804053856 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4053856
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.16, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGCGCTATGAGCCTCGATCGAGCTCTTGCAGCGGGTTTCAGCGCGTCCATGGCAGCCGACAGCAAGTTCTTGGCGGAGATAGCCATCCGCAGGCACGT[T/C]
GAAGCGTTCATGAATGTTAGCTCGCTGGTCGATGTCGGTGGCGGGGATGGCTCGATGGCGAGGGCCATTGTCAAGGCCTTCCCACACATCAAGTGCCTGG

Reverse complement sequence

CCAGGCACTTGATGTGTGGGAAGGCCTTGACAATGGCCCTCGCCATCGAGCCATCCCCGCCACCGACATCGACCAGCGAGCTAACATTCATGAACGCTTC[A/G]
ACGTGCCTGCGGATGGCTATCTCCGCCAAGAACTTGCTGTCGGCTGCCATGGACGCGCTGAAACCCGCTGCAAGAGCTCGATCGAGGCTCATAGCGCCCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.20% 40.00% 3.58% 15.21% NA
All Indica  2759 15.30% 53.60% 5.51% 25.59% NA
All Japonica  1512 93.60% 5.40% 0.79% 0.26% NA
Aus  269 3.70% 95.90% 0.00% 0.37% NA
Indica I  595 6.70% 37.50% 4.54% 51.26% NA
Indica II  465 50.30% 19.80% 19.14% 10.75% NA
Indica III  913 1.30% 74.40% 0.22% 24.10% NA
Indica Intermediate  786 17.40% 61.60% 4.33% 16.67% NA
Temperate Japonica  767 96.20% 2.00% 1.43% 0.39% NA
Tropical Japonica  504 87.30% 12.50% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 50.00% 35.60% 5.56% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804053856 T -> C LOC_Os08g07260.1 synonymous_variant ; p.Val141Val; LOW synonymous_codon Average:44.2; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N
vg0804053856 T -> C LOC_Os08g07260.1 synonymous_variant ; p.Val141Val; LOW nonsynonymous_codon ; V141A Average:44.2; most accessible tissue: Minghui63 young leaf, score: 78.821 benign -1.126 TOLERATED 0.46
vg0804053856 T -> DEL LOC_Os08g07260.1 N frameshift_variant Average:44.2; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804053856 NA 6.14E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0804053856 NA 3.22E-12 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0804053856 NA 4.86E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 7.55E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 1.45E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 4.36E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 8.38E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 3.92E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 7.38E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 8.20E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 1.26E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 3.74E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 2.72E-08 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 5.41E-12 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 9.87E-08 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 1.03E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 1.53E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 6.16E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 1.36E-08 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 5.62E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 6.67E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 2.20E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 6.58E-26 mr1874_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856 NA 1.67E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251