Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804053856:

Variant ID: vg0804053856 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4053856
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.16, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGCGCTATGAGCCTCGATCGAGCTCTTGCAGCGGGTTTCAGCGCGTCCATGGCAGCCGACAGCAAGTTCTTGGCGGAGATAGCCATCCGCAGGCACGT[T/C]
GAAGCGTTCATGAATGTTAGCTCGCTGGTCGATGTCGGTGGCGGGGATGGCTCGATGGCGAGGGCCATTGTCAAGGCCTTCCCACACATCAAGTGCCTGG

Reverse complement sequence

CCAGGCACTTGATGTGTGGGAAGGCCTTGACAATGGCCCTCGCCATCGAGCCATCCCCGCCACCGACATCGACCAGCGAGCTAACATTCATGAACGCTTC[A/G]
ACGTGCCTGCGGATGGCTATCTCCGCCAAGAACTTGCTGTCGGCTGCCATGGACGCGCTGAAACCCGCTGCAAGAGCTCGATCGAGGCTCATAGCGCCCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.20%	40.00%	3.58%	15.21%	NA
All Indica	2759	15.30%	53.60%	5.51%	25.59%	NA
All Japonica	1512	93.60%	5.40%	0.79%	0.26%	NA
Aus	269	3.70%	95.90%	0.00%	0.37%	NA
Indica I	595	6.70%	37.50%	4.54%	51.26%	NA
Indica II	465	50.30%	19.80%	19.14%	10.75%	NA
Indica III	913	1.30%	74.40%	0.22%	24.10%	NA
Indica Intermediate	786	17.40%	61.60%	4.33%	16.67%	NA
Temperate Japonica	767	96.20%	2.00%	1.43%	0.39%	NA
Tropical Japonica	504	87.30%	12.50%	0.00%	0.20%	NA
Japonica Intermediate	241	98.30%	1.20%	0.41%	0.00%	NA
VI/Aromatic	96	55.20%	44.80%	0.00%	0.00%	NA
Intermediate	90	50.00%	35.60%	5.56%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804053856	T -> C	LOC_Os08g07260.1	synonymous_variant ; p.Val141Val; LOW	synonymous_codon	Average:44.2; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N
vg0804053856	T -> C	LOC_Os08g07260.1	synonymous_variant ; p.Val141Val; LOW	nonsynonymous_codon ; V141A	Average:44.2; most accessible tissue: Minghui63 young leaf, score: 78.821	benign	-1.126	TOLERATED	0.46
vg0804053856	T -> DEL	LOC_Os08g07260.1	N	frameshift_variant	Average:44.2; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804053856	NA	6.14E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0804053856	NA	3.22E-12	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0804053856	NA	4.86E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	7.55E-14	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	1.45E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	4.36E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	8.38E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	3.92E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	7.38E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	8.20E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	1.26E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	3.74E-08	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	2.72E-08	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	5.41E-12	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	9.87E-08	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	1.03E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	1.53E-09	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	6.16E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	1.36E-08	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	5.62E-06	mr1806_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	6.67E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	2.20E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	6.58E-26	mr1874_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804053856	NA	1.67E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251