\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803430215:

Variant ID: vg0803430215 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3430215
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, G: 0.16, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTGCAAAGAAGTTGACTCACGTCTGCGATGGCGGATTCTCCGTAGGAAAAAGTACGAATTACCCCACCGAACTATCGCGGTCGTCTGAATTACCCCAT[A/G]
AACCATAAAACCGGATATTCTTTATCCCCAACTATGCAAACCGGACAAATTACCCCCTGACCCAATCCGCGGTGGCTTTAGTCTACGTGACATACGCGTG

Reverse complement sequence

CACGCGTATGTCACGTAGACTAAAGCCACCGCGGATTGGGTCAGGGGGTAATTTGTCCGGTTTGCATAGTTGGGGATAAAGAATATCCGGTTTTATGGTT[T/C]
ATGGGGTAATTCAGACGACCGCGATAGTTCGGTGGGGTAATTCGTACTTTTTCCTACGGAGAATCCGCCATCGCAGACGTGAGTCAACTTCTTTGCAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.40% 13.90% 0.30% 48.41% NA
All Indica  2759 20.80% 1.30% 0.36% 77.46% NA
All Japonica  1512 55.00% 40.10% 0.07% 4.83% NA
Aus  269 94.10% 1.50% 0.00% 4.46% NA
Indica I  595 10.80% 0.70% 0.00% 88.57% NA
Indica II  465 57.40% 0.90% 0.22% 41.51% NA
Indica III  913 8.00% 1.90% 0.77% 89.38% NA
Indica Intermediate  786 21.80% 1.50% 0.25% 76.46% NA
Temperate Japonica  767 35.20% 64.30% 0.13% 0.39% NA
Tropical Japonica  504 77.40% 9.90% 0.00% 12.70% NA
Japonica Intermediate  241 71.00% 26.60% 0.00% 2.49% NA
VI/Aromatic  96 60.40% 1.00% 1.04% 37.50% NA
Intermediate  90 57.80% 6.70% 2.22% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803430215 A -> G LOC_Os08g06220.1 upstream_gene_variant ; 690.0bp to feature; MODIFIER silent_mutation Average:59.787; most accessible tissue: Zhenshan97 panicle, score: 96.491 N N N N
vg0803430215 A -> G LOC_Os08g06210.1 downstream_gene_variant ; 2141.0bp to feature; MODIFIER silent_mutation Average:59.787; most accessible tissue: Zhenshan97 panicle, score: 96.491 N N N N
vg0803430215 A -> G LOC_Os08g06230.1 downstream_gene_variant ; 1626.0bp to feature; MODIFIER silent_mutation Average:59.787; most accessible tissue: Zhenshan97 panicle, score: 96.491 N N N N
vg0803430215 A -> G LOC_Os08g06210-LOC_Os08g06220 intergenic_region ; MODIFIER silent_mutation Average:59.787; most accessible tissue: Zhenshan97 panicle, score: 96.491 N N N N
vg0803430215 A -> DEL N N silent_mutation Average:59.787; most accessible tissue: Zhenshan97 panicle, score: 96.491 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0803430215 A G -0.11 -0.09 -0.07 -0.08 -0.08 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803430215 NA 5.93E-13 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0803430215 NA 4.27E-13 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0803430215 NA 2.38E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0803430215 NA 3.29E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 1.79E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 1.17E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 2.18E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 5.70E-07 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 2.88E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 6.68E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 1.05E-14 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 4.29E-11 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 5.62E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 2.00E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 2.31E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 1.53E-07 NA mr1062_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 4.93E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 3.52E-07 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803430215 NA 7.99E-09 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251