Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802780155:

Variant ID: vg0802780155 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2780155
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

CAGTTTTGTGATTAAATTGGCACTAAACATTTAGTCTTGTGAAAAAATTTTGCAACTGAATATATGGTTATGTGACCCTCCATCTTAAATTTGTAGTTTT[G/A]
TGATAAATTTGTCACACTAAATTTGTAATTTTTTAATACAACAGCTTAAATATATACTTTTACGATAGTTTAGTTAAGATGTCTGTAGTTTTATGAAATT

Reverse complement sequence

AATTTCATAAAACTACAGACATCTTAACTAAACTATCGTAAAAGTATATATTTAAGCTGTTGTATTAAAAAATTACAAATTTAGTGTGACAAATTTATCA[C/T]
AAAACTACAAATTTAAGATGGAGGGTCACATAACCATATATTCAGTTGCAAAATTTTTTCACAAGACTAAATGTTTAGTGCCAATTTAATCACAAAACTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.70%	7.60%	0.11%	0.55%	NA
All Indica	2759	86.10%	12.80%	0.18%	0.91%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	90.80%	8.20%	0.00%	1.08%	NA
Indica III	913	78.60%	19.70%	0.33%	1.31%	NA
Indica Intermediate	786	81.90%	16.80%	0.25%	1.02%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	6.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802780155	G -> A	LOC_Os08g05310.1	upstream_gene_variant ; 2771.0bp to feature; MODIFIER	silent_mutation	Average:41.3; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0802780155	G -> A	LOC_Os08g05300.1	downstream_gene_variant ; 3917.0bp to feature; MODIFIER	silent_mutation	Average:41.3; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0802780155	G -> A	LOC_Os08g05300-LOC_Os08g05310	intergenic_region ; MODIFIER	silent_mutation	Average:41.3; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0802780155	G -> DEL	N	N	silent_mutation	Average:41.3; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802780155	NA	1.61E-09	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0802780155	NA	1.28E-10	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0802780155	NA	2.68E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802780155	NA	3.14E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802780155	NA	4.16E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802780155	4.15E-06	4.15E-06	mr1964	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802780155	NA	2.40E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802780155	NA	8.57E-07	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802780155	NA	1.19E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251