Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801858513:

Variant ID: vg0801858513 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1858513
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, G: 0.30, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

TGCAGATTCTGGAAGAGTGTCTCTGCTATTCCGCTGGAAAGACTTGTATTTCGAGGGATTTTACTCCAAGGGTACGTATTACGGTATATCTAATCTACTC[G/T]
CTTTATCATGCATTATATTACTAACTTATTAAGAACACTAGCCATACTGCCTCTTGCTTGCTGGATGTGCCAATTGTTGTTGGTTGATTTGGTATGTATA

Reverse complement sequence

TATACATACCAAATCAACCAACAACAATTGGCACATCCAGCAAGCAAGAGGCAGTATGGCTAGTGTTCTTAATAAGTTAGTAATATAATGCATGATAAAG[C/A]
GAGTAGATTAGATATACCGTAATACGTACCCTTGGAGTAAAATCCCTCGAAATACAAGTCTTTCCAGCGGAATAGCAGAGACACTCTTCCAGAATCTGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.70%	39.90%	0.17%	5.23%	NA
All Indica	2759	57.10%	34.00%	0.22%	8.70%	NA
All Japonica	1512	59.00%	40.70%	0.13%	0.13%	NA
Aus	269	19.30%	80.30%	0.00%	0.37%	NA
Indica I	595	95.80%	4.00%	0.17%	0.00%	NA
Indica II	465	78.70%	9.00%	0.43%	11.83%	NA
Indica III	913	20.90%	68.70%	0.11%	10.30%	NA
Indica Intermediate	786	57.10%	31.00%	0.25%	11.58%	NA
Temperate Japonica	767	96.90%	2.70%	0.26%	0.13%	NA
Tropical Japonica	504	11.50%	88.50%	0.00%	0.00%	NA
Japonica Intermediate	241	37.80%	61.80%	0.00%	0.41%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	54.40%	41.10%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801858513	G -> T	LOC_Os08g03890.1	upstream_gene_variant ; 1503.0bp to feature; MODIFIER	silent_mutation	Average:74.178; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0801858513	G -> T	LOC_Os08g03910.1	upstream_gene_variant ; 4924.0bp to feature; MODIFIER	silent_mutation	Average:74.178; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0801858513	G -> T	LOC_Os08g03900.1	intron_variant ; MODIFIER	silent_mutation	Average:74.178; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0801858513	G -> DEL	N	N	silent_mutation	Average:74.178; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801858513	NA	1.48E-12	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801858513	NA	7.29E-11	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801858513	NA	1.27E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	1.78E-06	NA	mr1551	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	4.67E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	2.48E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	4.39E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	1.41E-09	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	2.08E-06	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	3.22E-09	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	5.59E-08	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	5.10E-09	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	2.90E-07	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	6.53E-09	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	7.01E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	4.83E-08	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	3.30E-10	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	3.53E-06	mr1359_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	6.52E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	4.18E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	2.20E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	5.63E-09	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	6.77E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	1.13E-07	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	2.81E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	1.88E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	1.41E-06	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	1.18E-07	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	1.56E-09	mr1864_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513	NA	3.63E-10	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251