\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801858513:

Variant ID: vg0801858513 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1858513
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, G: 0.30, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAGATTCTGGAAGAGTGTCTCTGCTATTCCGCTGGAAAGACTTGTATTTCGAGGGATTTTACTCCAAGGGTACGTATTACGGTATATCTAATCTACTC[G/T]
CTTTATCATGCATTATATTACTAACTTATTAAGAACACTAGCCATACTGCCTCTTGCTTGCTGGATGTGCCAATTGTTGTTGGTTGATTTGGTATGTATA

Reverse complement sequence

TATACATACCAAATCAACCAACAACAATTGGCACATCCAGCAAGCAAGAGGCAGTATGGCTAGTGTTCTTAATAAGTTAGTAATATAATGCATGATAAAG[C/A]
GAGTAGATTAGATATACCGTAATACGTACCCTTGGAGTAAAATCCCTCGAAATACAAGTCTTTCCAGCGGAATAGCAGAGACACTCTTCCAGAATCTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 39.90% 0.17% 5.23% NA
All Indica  2759 57.10% 34.00% 0.22% 8.70% NA
All Japonica  1512 59.00% 40.70% 0.13% 0.13% NA
Aus  269 19.30% 80.30% 0.00% 0.37% NA
Indica I  595 95.80% 4.00% 0.17% 0.00% NA
Indica II  465 78.70% 9.00% 0.43% 11.83% NA
Indica III  913 20.90% 68.70% 0.11% 10.30% NA
Indica Intermediate  786 57.10% 31.00% 0.25% 11.58% NA
Temperate Japonica  767 96.90% 2.70% 0.26% 0.13% NA
Tropical Japonica  504 11.50% 88.50% 0.00% 0.00% NA
Japonica Intermediate  241 37.80% 61.80% 0.00% 0.41% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 54.40% 41.10% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801858513 G -> T LOC_Os08g03890.1 upstream_gene_variant ; 1503.0bp to feature; MODIFIER silent_mutation Average:74.178; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N
vg0801858513 G -> T LOC_Os08g03910.1 upstream_gene_variant ; 4924.0bp to feature; MODIFIER silent_mutation Average:74.178; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N
vg0801858513 G -> T LOC_Os08g03900.1 intron_variant ; MODIFIER silent_mutation Average:74.178; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N
vg0801858513 G -> DEL N N silent_mutation Average:74.178; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801858513 NA 1.48E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801858513 NA 7.29E-11 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0801858513 NA 1.27E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 1.78E-06 NA mr1551 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 4.67E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 2.48E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 4.39E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 1.41E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 2.08E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 3.22E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 5.59E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 5.10E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 2.90E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 6.53E-09 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 7.01E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 4.83E-08 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 3.30E-10 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 3.53E-06 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 6.52E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 4.18E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 2.20E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 5.63E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 6.77E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 1.13E-07 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 2.81E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 1.88E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 1.41E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 1.18E-07 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 1.56E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801858513 NA 3.63E-10 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251