\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800629037:

Variant ID: vg0800629037 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 629037
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TGATATATACCTTCTGGCTAATCAGGTATAGAATGCAACTAAATTTACAAAAACAAGCTTTCAATACTATTCTAATTTGTAAGTTTAGTTTTGATATCTA[T/C]
TTTCTATAGCTATGTATATCTTAATTATGACGAAGTGTATACCTCTCCCAGATAAGAGAGAACGACTTGTAGTTGTTTGGCACAAATCCACCTTAGCAAC

Reverse complement sequence

GTTGCTAAGGTGGATTTGTGCCAAACAACTACAAGTCGTTCTCTCTTATCTGGGAGAGGTATACACTTCGTCATAATTAAGATATACATAGCTATAGAAA[A/G]
TAGATATCAAAACTAAACTTACAAATTAGAATAGTATTGAAAGCTTGTTTTTGTAAATTTAGTTGCATTCTATACCTGATTAGCCAGAAGGTATATATCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.60% 10.20% 1.50% 47.74% NA
All Indica  2759 27.70% 0.80% 1.12% 70.39% NA
All Japonica  1512 64.60% 29.70% 2.38% 3.37% NA
Aus  269 16.40% 0.00% 0.00% 83.64% NA
Indica I  595 20.80% 0.80% 2.02% 76.30% NA
Indica II  465 8.20% 1.90% 0.86% 89.03% NA
Indica III  913 39.10% 0.10% 0.22% 60.57% NA
Indica Intermediate  786 31.20% 0.90% 1.65% 66.28% NA
Temperate Japonica  767 42.40% 52.70% 3.52% 1.43% NA
Tropical Japonica  504 90.50% 1.60% 0.99% 6.94% NA
Japonica Intermediate  241 80.90% 15.40% 1.66% 2.07% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 47.80% 11.10% 4.44% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800629037 T -> C LOC_Os08g01980.1 downstream_gene_variant ; 3738.0bp to feature; MODIFIER silent_mutation Average:24.335; most accessible tissue: Callus, score: 62.244 N N N N
vg0800629037 T -> C LOC_Os08g01970-LOC_Os08g01980 intergenic_region ; MODIFIER silent_mutation Average:24.335; most accessible tissue: Callus, score: 62.244 N N N N
vg0800629037 T -> DEL N N silent_mutation Average:24.335; most accessible tissue: Callus, score: 62.244 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800629037 NA 1.62E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0800629037 NA 1.02E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0800629037 NA 1.61E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 5.45E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 1.72E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 1.03E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 2.60E-06 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 9.01E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 5.40E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 2.48E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 7.46E-06 5.65E-07 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 1.64E-06 mr1296_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 8.38E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 3.67E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 3.76E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 3.66E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 1.15E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 4.27E-06 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 2.53E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 9.86E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 4.28E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 2.19E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 7.00E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 2.48E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 5.42E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 2.26E-09 mr1865_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 4.93E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 8.24E-06 3.75E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 5.29E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 1.86E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 NA 1.87E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800629037 3.75E-06 4.66E-08 mr1996_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251