\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727588197:

Variant ID: vg0727588197 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27588197
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.14, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGCAAGAAAATGAAGAAATCGTTGGTGTAACTCGGAAGAAACGTCTCCATCTTCAGCCACTGGAAAATGACTCGAGACAATCAAAAGAGGCCAAATAC[G/A]
CCAAGACCTACGGCCCCATCTTTTTGGCTTATTCAACGTATTTGCAAACGAAAATCAATTTGTGAATAAACTTTTATATGCGTGTTCTTAGTGTTCTAAA

Reverse complement sequence

TTTAGAACACTAAGAACACGCATATAAAAGTTTATTCACAAATTGATTTTCGTTTGCAAATACGTTGAATAAGCCAAAAAGATGGGGCCGTAGGTCTTGG[C/T]
GTATTTGGCCTCTTTTGATTGTCTCGAGTCATTTTCCAGTGGCTGAAGATGGAGACGTTTCTTCCGAGTTACACCAACGATTTCTTCATTTTCTTGCGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.90% 29.70% 0.32% 0.08% NA
All Indica  2759 80.60% 18.80% 0.47% 0.14% NA
All Japonica  1512 57.50% 42.30% 0.13% 0.00% NA
Aus  269 25.70% 74.30% 0.00% 0.00% NA
Indica I  595 44.20% 55.00% 0.84% 0.00% NA
Indica II  465 90.50% 8.60% 0.65% 0.22% NA
Indica III  913 95.70% 4.10% 0.11% 0.11% NA
Indica Intermediate  786 84.60% 14.60% 0.51% 0.25% NA
Temperate Japonica  767 34.20% 65.60% 0.26% 0.00% NA
Tropical Japonica  504 87.30% 12.70% 0.00% 0.00% NA
Japonica Intermediate  241 69.70% 30.30% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727588197 G -> DEL N N silent_mutation Average:96.375; most accessible tissue: Zhenshan97 flag leaf, score: 99.002 N N N N
vg0727588197 G -> A LOC_Os07g46220.1 downstream_gene_variant ; 3912.0bp to feature; MODIFIER silent_mutation Average:96.375; most accessible tissue: Zhenshan97 flag leaf, score: 99.002 N N N N
vg0727588197 G -> A LOC_Os07g46230.1 downstream_gene_variant ; 835.0bp to feature; MODIFIER silent_mutation Average:96.375; most accessible tissue: Zhenshan97 flag leaf, score: 99.002 N N N N
vg0727588197 G -> A LOC_Os07g46240.1 downstream_gene_variant ; 2244.0bp to feature; MODIFIER silent_mutation Average:96.375; most accessible tissue: Zhenshan97 flag leaf, score: 99.002 N N N N
vg0727588197 G -> A LOC_Os07g46230-LOC_Os07g46240 intergenic_region ; MODIFIER silent_mutation Average:96.375; most accessible tissue: Zhenshan97 flag leaf, score: 99.002 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727588197 G A -0.03 -0.03 -0.08 -0.02 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727588197 NA 3.55E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0727588197 NA 2.78E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0727588197 NA 7.90E-13 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727588197 NA 2.79E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727588197 NA 3.43E-15 mr1002_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727588197 NA 1.22E-06 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727588197 NA 5.31E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727588197 NA 4.37E-12 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727588197 NA 1.41E-06 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251