\
| Variant ID: vg0727548424 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27548424 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.25, others allele: 0.00, population size: 263. )
TTTTCACCATATTTTTGTGTACTAATGCAATATAGCATTGGCAAGTGACAACTGCTTTCCGTTCTGATTGTTGCTGCTATTGTATGCGTTTTCAACCATA[A/T]
TTTTGTGCACTGTGTTGGCAAGTGACAACTGCATATACTGTTGTAGTGGAGTTCATGTTACTTGATTTGTGCTTACTAGCTTTAAAATATTTCATACTCC
GGAGTATGAAATATTTTAAAGCTAGTAAGCACAAATCAAGTAACATGAACTCCACTACAACAGTATATGCAGTTGTCACTTGCCAACACAGTGCACAAAA[T/A]
TATGGTTGAAAACGCATACAATAGCAGCAACAATCAGAACGGAAAGCAGTTGTCACTTGCCAATGCTATATTGCATTAGTACACAAAAATATGGTGAAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.70% | 42.00% | 0.00% | 0.23% | NA |
| All Indica | 2759 | 67.10% | 32.50% | 0.00% | 0.36% | NA |
| All Japonica | 1512 | 43.10% | 56.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 61.70% | 38.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.50% | 6.20% | 0.00% | 0.22% | NA |
| Indica III | 913 | 42.80% | 56.60% | 0.00% | 0.55% | NA |
| Indica Intermediate | 786 | 59.70% | 39.80% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 66.80% | 33.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 12.90% | 87.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 31.10% | 68.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727548424 | A -> DEL | N | N | silent_mutation | Average:61.494; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0727548424 | A -> T | LOC_Os07g46150.1 | upstream_gene_variant ; 4542.0bp to feature; MODIFIER | silent_mutation | Average:61.494; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0727548424 | A -> T | LOC_Os07g46170.1 | upstream_gene_variant ; 2408.0bp to feature; MODIFIER | silent_mutation | Average:61.494; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0727548424 | A -> T | LOC_Os07g46160.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.494; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727548424 | NA | 2.01E-12 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0727548424 | 9.68E-06 | 1.34E-09 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727548424 | NA | 1.70E-12 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727548424 | NA | 3.77E-09 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727548424 | NA | 1.30E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727548424 | NA | 2.39E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727548424 | NA | 8.28E-14 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727548424 | NA | 2.99E-06 | mr1186_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727548424 | NA | 7.73E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727548424 | 8.40E-07 | NA | mr1368_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727548424 | NA | 4.73E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727548424 | NA | 1.13E-06 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |