\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727548424:

Variant ID: vg0727548424 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27548424
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.25, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCACCATATTTTTGTGTACTAATGCAATATAGCATTGGCAAGTGACAACTGCTTTCCGTTCTGATTGTTGCTGCTATTGTATGCGTTTTCAACCATA[A/T]
TTTTGTGCACTGTGTTGGCAAGTGACAACTGCATATACTGTTGTAGTGGAGTTCATGTTACTTGATTTGTGCTTACTAGCTTTAAAATATTTCATACTCC

Reverse complement sequence

GGAGTATGAAATATTTTAAAGCTAGTAAGCACAAATCAAGTAACATGAACTCCACTACAACAGTATATGCAGTTGTCACTTGCCAACACAGTGCACAAAA[T/A]
TATGGTTGAAAACGCATACAATAGCAGCAACAATCAGAACGGAAAGCAGTTGTCACTTGCCAATGCTATATTGCATTAGTACACAAAAATATGGTGAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 42.00% 0.00% 0.23% NA
All Indica  2759 67.10% 32.50% 0.00% 0.36% NA
All Japonica  1512 43.10% 56.90% 0.00% 0.00% NA
Aus  269 61.70% 38.30% 0.00% 0.00% NA
Indica I  595 93.40% 6.60% 0.00% 0.00% NA
Indica II  465 93.50% 6.20% 0.00% 0.22% NA
Indica III  913 42.80% 56.60% 0.00% 0.55% NA
Indica Intermediate  786 59.70% 39.80% 0.00% 0.51% NA
Temperate Japonica  767 66.80% 33.20% 0.00% 0.00% NA
Tropical Japonica  504 12.90% 87.10% 0.00% 0.00% NA
Japonica Intermediate  241 31.10% 68.90% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727548424 A -> DEL N N silent_mutation Average:61.494; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0727548424 A -> T LOC_Os07g46150.1 upstream_gene_variant ; 4542.0bp to feature; MODIFIER silent_mutation Average:61.494; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0727548424 A -> T LOC_Os07g46170.1 upstream_gene_variant ; 2408.0bp to feature; MODIFIER silent_mutation Average:61.494; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0727548424 A -> T LOC_Os07g46160.1 intron_variant ; MODIFIER silent_mutation Average:61.494; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727548424 NA 2.01E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0727548424 9.68E-06 1.34E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424 NA 1.70E-12 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424 NA 3.77E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424 NA 1.30E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424 NA 2.39E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424 NA 8.28E-14 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424 NA 2.99E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424 NA 7.73E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424 8.40E-07 NA mr1368_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424 NA 4.73E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424 NA 1.13E-06 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251