\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727531115:

Variant ID: vg0727531115 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27531115
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


ATATATGTGCTGCAATCATACTGTCATTTGGCAACTTACATATCCCAGCAGCACTCGTGCGTGTCAGCCTCGCGGGGTATCGCCTTGCAGAACATAACTA[C/T]
TTCGGTGTTGATGACCAAAAAAATTTTGGTGAATCTCTAACCATCTTCTATAGCATGGTGCTTGGCCAAGGAATACTTTACATCGTTGCAGGCATACTGG

Reverse complement sequence

CCAGTATGCCTGCAACGATGTAAAGTATTCCTTGGCCAAGCACCATGCTATAGAAGATGGTTAGAGATTCACCAAAATTTTTTTGGTCATCAACACCGAA[G/A]
TAGTTATGTTCTGCAAGGCGATACCCCGCGAGGCTGACACGCACGAGTGCTGCTGGGATATGTAAGTTGCCAAATGACAGTATGATTGCAGCACATATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 35.00% 0.53% 0.80% NA
All Indica  2759 73.20% 24.80% 0.69% 1.38% NA
All Japonica  1512 43.80% 55.80% 0.40% 0.00% NA
Aus  269 62.50% 37.50% 0.00% 0.00% NA
Indica I  595 95.30% 3.40% 0.34% 1.01% NA
Indica II  465 94.00% 6.00% 0.00% 0.00% NA
Indica III  913 53.50% 42.60% 1.31% 2.63% NA
Indica Intermediate  786 67.00% 31.30% 0.64% 1.02% NA
Temperate Japonica  767 67.00% 32.70% 0.26% 0.00% NA
Tropical Japonica  504 13.50% 85.70% 0.79% 0.00% NA
Japonica Intermediate  241 33.20% 66.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727531115 C -> DEL LOC_Os07g46130.1 N frameshift_variant Average:66.172; most accessible tissue: Minghui63 flag leaf, score: 87.98 N N N N
vg0727531115 C -> T LOC_Os07g46130.1 synonymous_variant ; p.Tyr236Tyr; LOW synonymous_codon Average:66.172; most accessible tissue: Minghui63 flag leaf, score: 87.98 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727531115 C T -0.01 -0.02 -0.01 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727531115 NA 1.01E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0727531115 NA 1.08E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 3.45E-11 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 9.50E-06 mr1187 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 7.77E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 3.14E-06 mr1554 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 6.00E-12 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 1.19E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 1.73E-06 mr1952 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 5.46E-12 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 7.00E-07 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 5.57E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 3.95E-06 NA mr1368_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 1.46E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 7.44E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 1.86E-06 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 3.09E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727531115 NA 7.26E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251