\
| Variant ID: vg0727505200 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27505200 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GAACCCTCGTCCGCCGTGGTGGATTCACAGGCCAATGGGGAGTTGAATCTGTCAATCTATACTACACATACGCCTTCGAGAAAAACATGGAAGGAGGTGT[A/G]
TTTGCTGCAAAGAGGATCAGCCTCAGCAACTTTGCCATGGATTCTATAAATTCTGACTTGTCCAAGAAACAGCTGTATGGGATCTGGATGATGCACATTT
AAATGTGCATCATCCAGATCCCATACAGCTGTTTCTTGGACAAGTCAGAATTTATAGAATCCATGGCAAAGTTGCTGAGGCTGATCCTCTTTGCAGCAAA[T/C]
ACACCTCCTTCCATGTTTTTCTCGAAGGCGTATGTGTAGTATAGATTGACAGATTCAACTCCCCATTGGCCTGTGAATCCACCACGGCGGACGAGGGTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 19.50% | 0.50% | 5.40% | 74.61% | NA |
| All Indica | 2759 | 8.20% | 0.30% | 5.29% | 86.23% | NA |
| All Japonica | 1512 | 43.70% | 0.80% | 1.32% | 54.23% | NA |
| Aus | 269 | 1.50% | 0.40% | 27.14% | 71.00% | NA |
| Indica I | 595 | 11.30% | 0.00% | 0.67% | 88.07% | NA |
| Indica II | 465 | 6.20% | 0.20% | 1.08% | 92.47% | NA |
| Indica III | 913 | 8.50% | 0.70% | 10.95% | 79.85% | NA |
| Indica Intermediate | 786 | 6.50% | 0.30% | 4.71% | 88.55% | NA |
| Temperate Japonica | 767 | 66.80% | 0.30% | 0.65% | 32.33% | NA |
| Tropical Japonica | 504 | 15.10% | 1.60% | 2.58% | 80.75% | NA |
| Japonica Intermediate | 241 | 29.90% | 0.80% | 0.83% | 68.46% | NA |
| VI/Aromatic | 96 | 4.20% | 0.00% | 12.50% | 83.33% | NA |
| Intermediate | 90 | 33.30% | 0.00% | 4.44% | 62.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727505200 | A -> DEL | LOC_Os07g46080.1 | N | frameshift_variant | Average:10.519; most accessible tissue: Callus, score: 45.11 | N | N | N | N |
| vg0727505200 | A -> G | LOC_Os07g46080.1 | synonymous_variant ; p.Val300Val; LOW | synonymous_codon | Average:10.519; most accessible tissue: Callus, score: 45.11 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727505200 | NA | 6.39E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0727505200 | NA | 1.78E-09 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 1.57E-13 | mr1002 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 2.65E-06 | mr1187 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 9.60E-12 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 4.41E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 2.34E-08 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 2.26E-06 | mr1952 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 3.79E-14 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 7.56E-06 | mr1186_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 3.24E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 9.40E-06 | mr1616_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 6.90E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 4.98E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 5.56E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727505200 | NA | 2.78E-06 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |