\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727505200:

Variant ID: vg0727505200 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27505200
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACCCTCGTCCGCCGTGGTGGATTCACAGGCCAATGGGGAGTTGAATCTGTCAATCTATACTACACATACGCCTTCGAGAAAAACATGGAAGGAGGTGT[A/G]
TTTGCTGCAAAGAGGATCAGCCTCAGCAACTTTGCCATGGATTCTATAAATTCTGACTTGTCCAAGAAACAGCTGTATGGGATCTGGATGATGCACATTT

Reverse complement sequence

AAATGTGCATCATCCAGATCCCATACAGCTGTTTCTTGGACAAGTCAGAATTTATAGAATCCATGGCAAAGTTGCTGAGGCTGATCCTCTTTGCAGCAAA[T/C]
ACACCTCCTTCCATGTTTTTCTCGAAGGCGTATGTGTAGTATAGATTGACAGATTCAACTCCCCATTGGCCTGTGAATCCACCACGGCGGACGAGGGTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.50% 0.50% 5.40% 74.61% NA
All Indica  2759 8.20% 0.30% 5.29% 86.23% NA
All Japonica  1512 43.70% 0.80% 1.32% 54.23% NA
Aus  269 1.50% 0.40% 27.14% 71.00% NA
Indica I  595 11.30% 0.00% 0.67% 88.07% NA
Indica II  465 6.20% 0.20% 1.08% 92.47% NA
Indica III  913 8.50% 0.70% 10.95% 79.85% NA
Indica Intermediate  786 6.50% 0.30% 4.71% 88.55% NA
Temperate Japonica  767 66.80% 0.30% 0.65% 32.33% NA
Tropical Japonica  504 15.10% 1.60% 2.58% 80.75% NA
Japonica Intermediate  241 29.90% 0.80% 0.83% 68.46% NA
VI/Aromatic  96 4.20% 0.00% 12.50% 83.33% NA
Intermediate  90 33.30% 0.00% 4.44% 62.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727505200 A -> DEL LOC_Os07g46080.1 N frameshift_variant Average:10.519; most accessible tissue: Callus, score: 45.11 N N N N
vg0727505200 A -> G LOC_Os07g46080.1 synonymous_variant ; p.Val300Val; LOW synonymous_codon Average:10.519; most accessible tissue: Callus, score: 45.11 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727505200 NA 6.39E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0727505200 NA 1.78E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 1.57E-13 mr1002 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 2.65E-06 mr1187 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 9.60E-12 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 4.41E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 2.34E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 2.26E-06 mr1952 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 3.79E-14 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 7.56E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 3.24E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 9.40E-06 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 6.90E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 4.98E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 5.56E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727505200 NA 2.78E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251