\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724428077:

Variant ID: vg0724428077 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24428077
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TGATGAGACACAGTGGGAAAAAACTCCATTTCCAGATGTAGACCCACCTGTGGCTAGGACACAACCAGGGAGGCCAAAAACAAAGAGAACTAGAGCATCT[G/A]
ATGAACCTAGGGTTCAAGGAAGGTCGGTTGCAAAGACAACAATTAGATGTAGCGTCTGCAAAGAGTTTGGTCATAACAGCAGAAAGCATGGAAAAGACAA

Reverse complement sequence

TTGTCTTTTCCATGCTTTCTGCTGTTATGACCAAACTCTTTGCAGACGCTACATCTAATTGTTGTCTTTGCAACCGACCTTCCTTGAACCCTAGGTTCAT[C/T]
AGATGCTCTAGTTCTCTTTGTTTTTGGCCTCCCTGGTTGTGTCCTAGCCACAGGTGGGTCTACATCTGGAAATGGAGTTTTTTCCCACTGTGTCTCATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 6.90% 0.00% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 81.00% 19.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 67.50% 32.50% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 86.30% 13.70% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724428077 G -> A LOC_Os07g40760.1 missense_variant ; p.Asp1063Asn; MODERATE nonsynonymous_codon ; D1063N Average:13.216; most accessible tissue: Minghui63 panicle, score: 20.733 unknown unknown TOLERATED 0.22

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724428077 NA 1.35E-16 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724428077 NA 3.14E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724428077 NA 3.84E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724428077 3.05E-06 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 8.80E-08 7.58E-12 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 8.90E-13 2.45E-15 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 3.12E-11 3.12E-11 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 6.75E-24 5.76E-19 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 6.58E-17 1.05E-25 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 3.74E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 2.00E-24 7.29E-27 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 1.25E-14 1.38E-17 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 6.87E-13 1.33E-19 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 2.72E-09 1.59E-10 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 NA 1.26E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 1.28E-07 3.81E-10 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 7.79E-06 7.79E-06 mr1181_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 1.96E-06 NA mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 3.56E-30 1.32E-21 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 2.94E-20 1.10E-29 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 3.59E-15 1.01E-17 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 2.20E-09 2.78E-12 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 NA 3.11E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 1.28E-13 1.42E-26 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 3.72E-07 8.95E-11 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 1.02E-07 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 4.16E-06 NA mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 8.02E-07 NA mr1720_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 2.31E-32 1.83E-35 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 1.63E-14 1.59E-21 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 3.83E-08 7.56E-19 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 2.58E-31 2.99E-43 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724428077 5.95E-14 4.08E-21 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251