\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724381738:

Variant ID: vg0724381738 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24381738
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTGGGCCATCCTCTACAAACCGGGACTTCGGGATACTATTGCGGTGGTATCACAACGTTTCGACCAGGTAGCACAGGAGTTTTTTTTTTTACCCAGAA[G/A]
CATGGGTGGCGACCTAGTCTCTACGGATTGATAACCACTAGTTTCTATGTTTTGTGATGGGGAAGTCTTCTTAGGTCTAGTGTTTTTGGCTGTGTGAATT

Reverse complement sequence

AATTCACACAGCCAAAAACACTAGACCTAAGAAGACTTCCCCATCACAAAACATAGAAACTAGTGGTTATCAATCCGTAGAGACTAGGTCGCCACCCATG[C/T]
TTCTGGGTAAAAAAAAAAACTCCTGTGCTACCTGGTCGAAACGTTGTGATACCACCGCAATAGTATCCCGAAGTCCCGGTTTGTAGAGGATGGCCCAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.20% 26.50% 0.17% 0.13% NA
All Indica  2759 71.50% 28.00% 0.25% 0.18% NA
All Japonica  1512 79.20% 20.80% 0.00% 0.00% NA
Aus  269 68.40% 31.60% 0.00% 0.00% NA
Indica I  595 16.10% 83.40% 0.34% 0.17% NA
Indica II  465 86.20% 13.80% 0.00% 0.00% NA
Indica III  913 99.00% 0.90% 0.11% 0.00% NA
Indica Intermediate  786 72.90% 26.10% 0.51% 0.51% NA
Temperate Japonica  767 66.50% 33.50% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 78.80% 21.20% 0.00% 0.00% NA
VI/Aromatic  96 33.30% 65.60% 0.00% 1.04% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724381738 G -> DEL N N silent_mutation Average:65.182; most accessible tissue: Minghui63 flower, score: 85.848 N N N N
vg0724381738 G -> A LOC_Os07g40690.1 upstream_gene_variant ; 2670.0bp to feature; MODIFIER silent_mutation Average:65.182; most accessible tissue: Minghui63 flower, score: 85.848 N N N N
vg0724381738 G -> A LOC_Os07g40680.1 downstream_gene_variant ; 3672.0bp to feature; MODIFIER silent_mutation Average:65.182; most accessible tissue: Minghui63 flower, score: 85.848 N N N N
vg0724381738 G -> A LOC_Os07g40680-LOC_Os07g40690 intergenic_region ; MODIFIER silent_mutation Average:65.182; most accessible tissue: Minghui63 flower, score: 85.848 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724381738 G A -0.04 -0.02 -0.01 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724381738 NA 1.04E-13 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724381738 NA 8.31E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724381738 2.35E-08 1.76E-11 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 NA 1.67E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 2.20E-08 NA mr1343 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 4.14E-11 4.14E-11 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 1.98E-16 1.17E-15 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 3.14E-21 7.52E-27 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 1.49E-11 4.73E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 1.81E-15 1.57E-16 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 1.56E-06 NA mr1902 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 1.21E-08 6.38E-09 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 1.90E-08 1.11E-10 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 7.57E-07 NA mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 1.05E-18 7.57E-14 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 1.13E-25 3.33E-28 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 6.42E-06 5.58E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 2.27E-07 3.79E-10 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 NA 2.29E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 NA 2.38E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 NA 1.34E-09 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 NA 9.02E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 7.92E-07 NA mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 9.79E-15 5.79E-12 mr1829_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 2.13E-17 3.58E-20 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 1.13E-12 NA mr1902_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724381738 1.44E-16 2.53E-20 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251