\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724379241:

Variant ID: vg0724379241 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24379241
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TATTAGGATTAGACTAAGAATCGAACTCTATCTTAGAATCTATCTTAAATAGAGGGGCATGCCTACTGTAATCGTATGGAGACTTAGCATAGCGAGAGGG[A/G]
GCGGATGCCGACAGCGACCGGCTGTGAGTCGTTGTAACTCTGATATGTTGTAATATGCTGAATCGGGAAAGAGCGCTAGTAATTAGTGCCCCGGAGATGT

Reverse complement sequence

ACATCTCCGGGGCACTAATTACTAGCGCTCTTTCCCGATTCAGCATATTACAACATATCAGAGTTACAACGACTCACAGCCGGTCGCTGTCGGCATCCGC[T/C]
CCCTCTCGCTATGCTAAGTCTCCATACGATTACAGTAGGCATGCCCCTCTATTTAAGATAGATTCTAAGATAGAGTTCGATTCTTAGTCTAATCCTAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 38.80% 0.06% 0.28% NA
All Indica  2759 69.40% 30.20% 0.00% 0.36% NA
All Japonica  1512 47.40% 52.40% 0.13% 0.00% NA
Aus  269 61.30% 38.70% 0.00% 0.00% NA
Indica I  595 13.80% 85.90% 0.00% 0.34% NA
Indica II  465 84.10% 15.90% 0.00% 0.00% NA
Indica III  913 98.80% 1.10% 0.00% 0.11% NA
Indica Intermediate  786 68.80% 30.30% 0.00% 0.89% NA
Temperate Japonica  767 6.60% 93.40% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 70.50% 29.00% 0.41% 0.00% NA
VI/Aromatic  96 28.10% 69.80% 0.00% 2.08% NA
Intermediate  90 57.80% 40.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724379241 A -> DEL N N silent_mutation Average:57.452; most accessible tissue: Minghui63 flower, score: 79.848 N N N N
vg0724379241 A -> G LOC_Os07g40680.1 downstream_gene_variant ; 1175.0bp to feature; MODIFIER silent_mutation Average:57.452; most accessible tissue: Minghui63 flower, score: 79.848 N N N N
vg0724379241 A -> G LOC_Os07g40680-LOC_Os07g40690 intergenic_region ; MODIFIER silent_mutation Average:57.452; most accessible tissue: Minghui63 flower, score: 79.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724379241 NA 2.48E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724379241 NA 4.87E-07 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 5.77E-11 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 1.53E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 4.54E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 3.80E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 2.85E-06 NA mr1063_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 3.42E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 5.86E-09 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 1.44E-07 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 3.12E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 9.10E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 5.31E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 9.97E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 5.07E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 9.14E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 2.34E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 1.02E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 9.59E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 4.17E-15 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 1.30E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 1.08E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 9.23E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 1.62E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 1.56E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724379241 NA 4.18E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251