\
| Variant ID: vg0724065640 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24065640 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.03, others allele: 0.00, population size: 108. )
GAGAAAAAAACGGTCAGAAAAAACGTGCCATTTCTAAAAAATGGTTTGAAAAAACCGTGCAAAAAAAACACCGTCTATTAAAAAACAAATCGCTTTGAAA[A/G]
AACTGTCAGAGAAAATACTAAATTGATGGATGCTTGACTCGGATAGGATCCATCGATTTTTTGCCATCTACTATACGGCTTTTATTTCGTCATATATTCT
AGAATATATGACGAAATAAAAGCCGTATAGTAGATGGCAAAAAATCGATGGATCCTATCCGAGTCAAGCATCCATCAATTTAGTATTTTCTCTGACAGTT[T/C]
TTTCAAAGCGATTTGTTTTTTAATAGACGGTGTTTTTTTTGCACGGTTTTTTCAAACCATTTTTTAGAAATGGCACGTTTTTTCTGACCGTTTTTTTCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.90% | 12.80% | 1.29% | 0.00% | NA |
| All Indica | 2759 | 76.10% | 21.70% | 2.17% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 25.70% | 66.70% | 7.56% | 0.00% | NA |
| Indica II | 465 | 89.00% | 10.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.80% | 19.60% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724065640 | A -> G | LOC_Os07g40090.1 | upstream_gene_variant ; 3921.0bp to feature; MODIFIER | silent_mutation | Average:14.086; most accessible tissue: Callus, score: 21.65 | N | N | N | N |
| vg0724065640 | A -> G | LOC_Os07g40100.1 | downstream_gene_variant ; 1095.0bp to feature; MODIFIER | silent_mutation | Average:14.086; most accessible tissue: Callus, score: 21.65 | N | N | N | N |
| vg0724065640 | A -> G | LOC_Os07g40110.1 | downstream_gene_variant ; 4424.0bp to feature; MODIFIER | silent_mutation | Average:14.086; most accessible tissue: Callus, score: 21.65 | N | N | N | N |
| vg0724065640 | A -> G | LOC_Os07g40090-LOC_Os07g40100 | intergenic_region ; MODIFIER | silent_mutation | Average:14.086; most accessible tissue: Callus, score: 21.65 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724065640 | NA | 8.84E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0724065640 | NA | 4.44E-17 | Heading_date | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0724065640 | NA | 6.72E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 7.98E-10 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 5.00E-06 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 5.45E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 1.13E-12 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 2.15E-10 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 1.29E-08 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 2.85E-09 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 1.08E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 1.31E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 3.90E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 4.75E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 3.01E-11 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724065640 | NA | 4.02E-06 | mr1629_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |