\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724065640:

Variant ID: vg0724065640 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24065640
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.03, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


GAGAAAAAAACGGTCAGAAAAAACGTGCCATTTCTAAAAAATGGTTTGAAAAAACCGTGCAAAAAAAACACCGTCTATTAAAAAACAAATCGCTTTGAAA[A/G]
AACTGTCAGAGAAAATACTAAATTGATGGATGCTTGACTCGGATAGGATCCATCGATTTTTTGCCATCTACTATACGGCTTTTATTTCGTCATATATTCT

Reverse complement sequence

AGAATATATGACGAAATAAAAGCCGTATAGTAGATGGCAAAAAATCGATGGATCCTATCCGAGTCAAGCATCCATCAATTTAGTATTTTCTCTGACAGTT[T/C]
TTTCAAAGCGATTTGTTTTTTAATAGACGGTGTTTTTTTTGCACGGTTTTTTCAAACCATTTTTTAGAAATGGCACGTTTTTTCTGACCGTTTTTTTCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 12.80% 1.29% 0.00% NA
All Indica  2759 76.10% 21.70% 2.17% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 25.70% 66.70% 7.56% 0.00% NA
Indica II  465 89.00% 10.50% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 78.80% 19.60% 1.65% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724065640 A -> G LOC_Os07g40090.1 upstream_gene_variant ; 3921.0bp to feature; MODIFIER silent_mutation Average:14.086; most accessible tissue: Callus, score: 21.65 N N N N
vg0724065640 A -> G LOC_Os07g40100.1 downstream_gene_variant ; 1095.0bp to feature; MODIFIER silent_mutation Average:14.086; most accessible tissue: Callus, score: 21.65 N N N N
vg0724065640 A -> G LOC_Os07g40110.1 downstream_gene_variant ; 4424.0bp to feature; MODIFIER silent_mutation Average:14.086; most accessible tissue: Callus, score: 21.65 N N N N
vg0724065640 A -> G LOC_Os07g40090-LOC_Os07g40100 intergenic_region ; MODIFIER silent_mutation Average:14.086; most accessible tissue: Callus, score: 21.65 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724065640 NA 8.84E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724065640 NA 4.44E-17 Heading_date Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724065640 NA 6.72E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 7.98E-10 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 5.00E-06 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 5.45E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 1.13E-12 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 2.15E-10 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 1.29E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 2.85E-09 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 1.08E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 1.31E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 3.90E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 4.75E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 3.01E-11 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724065640 NA 4.02E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251