\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722099669:

Variant ID: vg0722099669 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22099669
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCTTTTTCAATCAGGGGAGTAAACTTTAAAAATCAGAGTATTTTGTAGCGAGCATTTCTACCCTCCGAATCCAAGAGAAGCTGCAGCATTCTACCGGC[G/A]
AGGGCTCGGCGGCGGAAGGCAACGAGGAACTGGAGGCCTTCGTATTTGAGTAAATTTTATGTATATCCTTGAAAACTCGCTCAATCCTTTTTATACCGCT

Reverse complement sequence

AGCGGTATAAAAAGGATTGAGCGAGTTTTCAAGGATATACATAAAATTTACTCAAATACGAAGGCCTCCAGTTCCTCGTTGCCTTCCGCCGCCGAGCCCT[C/T]
GCCGGTAGAATGCTGCAGCTTCTCTTGGATTCGGAGGGTAGAAATGCTCGCTACAAAATACTCTGATTTTTAAAGTTTACTCCCCTGATTGAAAAAGGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 7.90% 0.00% 0.00% NA
All Indica  2759 97.50% 2.50% 0.00% 0.00% NA
All Japonica  1512 80.20% 19.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 92.50% 7.50% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.90% 0.00% 0.00% NA
Temperate Japonica  767 94.30% 5.70% 0.00% 0.00% NA
Tropical Japonica  504 63.70% 36.30% 0.00% 0.00% NA
Japonica Intermediate  241 70.10% 29.90% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722099669 G -> A LOC_Os07g36900.1 upstream_gene_variant ; 392.0bp to feature; MODIFIER silent_mutation Average:47.25; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0722099669 G -> A LOC_Os07g36910.1 upstream_gene_variant ; 2248.0bp to feature; MODIFIER silent_mutation Average:47.25; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0722099669 G -> A LOC_Os07g36910.2 upstream_gene_variant ; 2248.0bp to feature; MODIFIER silent_mutation Average:47.25; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0722099669 G -> A LOC_Os07g36900-LOC_Os07g36910 intergenic_region ; MODIFIER silent_mutation Average:47.25; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722099669 1.08E-06 NA Grain_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722099669 NA 4.72E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722099669 2.84E-07 1.31E-13 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722099669 NA 2.27E-07 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722099669 NA 5.81E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669 NA 1.48E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669 NA 2.77E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669 NA 2.26E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669 NA 1.78E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669 NA 1.78E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669 NA 7.86E-10 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669 NA 5.70E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669 NA 3.40E-15 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669 NA 5.09E-15 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669 NA 1.75E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669 NA 1.23E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669 NA 5.88E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251