Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722099669:

Variant ID: vg0722099669 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 22099669
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCTTTTTCAATCAGGGGAGTAAACTTTAAAAATCAGAGTATTTTGTAGCGAGCATTTCTACCCTCCGAATCCAAGAGAAGCTGCAGCATTCTACCGGC[G/A]
AGGGCTCGGCGGCGGAAGGCAACGAGGAACTGGAGGCCTTCGTATTTGAGTAAATTTTATGTATATCCTTGAAAACTCGCTCAATCCTTTTTATACCGCT

Reverse complement sequence

AGCGGTATAAAAAGGATTGAGCGAGTTTTCAAGGATATACATAAAATTTACTCAAATACGAAGGCCTCCAGTTCCTCGTTGCCTTCCGCCGCCGAGCCCT[C/T]
GCCGGTAGAATGCTGCAGCTTCTCTTGGATTCGGAGGGTAGAAATGCTCGCTACAAAATACTCTGATTTTTAAAGTTTACTCCCCTGATTGAAAAAGGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.10%	7.90%	0.00%	0.00%	NA
All Indica	2759	97.50%	2.50%	0.00%	0.00%	NA
All Japonica	1512	80.20%	19.80%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	92.50%	7.50%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	96.10%	3.90%	0.00%	0.00%	NA
Temperate Japonica	767	94.30%	5.70%	0.00%	0.00%	NA
Tropical Japonica	504	63.70%	36.30%	0.00%	0.00%	NA
Japonica Intermediate	241	70.10%	29.90%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0722099669	G -> A	LOC_Os07g36900.1	upstream_gene_variant ; 392.0bp to feature; MODIFIER	silent_mutation	Average:47.25; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0722099669	G -> A	LOC_Os07g36910.1	upstream_gene_variant ; 2248.0bp to feature; MODIFIER	silent_mutation	Average:47.25; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0722099669	G -> A	LOC_Os07g36910.2	upstream_gene_variant ; 2248.0bp to feature; MODIFIER	silent_mutation	Average:47.25; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0722099669	G -> A	LOC_Os07g36900-LOC_Os07g36910	intergenic_region ; MODIFIER	silent_mutation	Average:47.25; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0722099669	1.08E-06	NA	Grain_length	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722099669	NA	4.72E-14	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722099669	2.84E-07	1.31E-13	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722099669	NA	2.27E-07	Grain_weight	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722099669	NA	5.81E-10	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669	NA	1.48E-08	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669	NA	2.77E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669	NA	2.26E-10	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669	NA	1.78E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669	NA	1.78E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669	NA	7.86E-10	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669	NA	5.70E-12	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669	NA	3.40E-15	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669	NA	5.09E-15	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669	NA	1.75E-14	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669	NA	1.23E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722099669	NA	5.88E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251