\
| Variant ID: vg0721447322 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21447322 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCCAGATAAGTAAGGACAAGTAGAGTTCTATATGAAAACTATATGGACTACTCAAATTGTATCCATATTGGTATTTGTAGTTATGTTTGGACAATGGGA[C/T]
ATCTATGGGTATAAATACAAGACCCCCTAAAGAAGGGGGAGGAGACCAACACAAGCCAAGACAAAGCCAGATATCGACATCAGAGATTAGCCTAGACAGA
TCTGTCTAGGCTAATCTCTGATGTCGATATCTGGCTTTGTCTTGGCTTGTGTTGGTCTCCTCCCCCTTCTTTAGGGGGTCTTGTATTTATACCCATAGAT[G/A]
TCCCATTGTCCAAACATAACTACAAATACCAATATGGATACAATTTGAGTAGTCCATATAGTTTTCATATAGAACTCTACTTGTCCTTACTTATCTGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.70% | 15.90% | 1.40% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 53.80% | 42.10% | 4.03% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.40% | 3.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 70.90% | 21.30% | 7.82% | 0.00% | NA |
| Tropical Japonica | 504 | 28.60% | 71.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 52.30% | 47.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 63.50% | 34.40% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721447322 | C -> T | LOC_Os07g35810.1 | upstream_gene_variant ; 2499.0bp to feature; MODIFIER | silent_mutation | Average:53.28; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0721447322 | C -> T | LOC_Os07g35820.1 | downstream_gene_variant ; 765.0bp to feature; MODIFIER | silent_mutation | Average:53.28; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0721447322 | C -> T | LOC_Os07g35810-LOC_Os07g35820 | intergenic_region ; MODIFIER | silent_mutation | Average:53.28; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721447322 | NA | 2.97E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447322 | 8.69E-07 | 8.70E-07 | mr1572 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447322 | NA | 1.47E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447322 | 5.63E-06 | 5.71E-06 | mr1899 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447322 | 1.44E-06 | 1.44E-06 | mr1899 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447322 | NA | 1.24E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447322 | NA | 8.71E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447322 | NA | 3.92E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447322 | NA | 5.20E-07 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447322 | NA | 2.56E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447322 | NA | 7.16E-11 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447322 | NA | 1.07E-13 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |