\
| Variant ID: vg0721447320 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21447320 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTTCCAGATAAGTAAGGACAAGTAGAGTTCTATATGAAAACTATATGGACTACTCAAATTGTATCCATATTGGTATTTGTAGTTATGTTTGGACAATGG[G/A]
ACATCTATGGGTATAAATACAAGACCCCCTAAAGAAGGGGGAGGAGACCAACACAAGCCAAGACAAAGCCAGATATCGACATCAGAGATTAGCCTAGACA
TGTCTAGGCTAATCTCTGATGTCGATATCTGGCTTTGTCTTGGCTTGTGTTGGTCTCCTCCCCCTTCTTTAGGGGGTCTTGTATTTATACCCATAGATGT[C/T]
CCATTGTCCAAACATAACTACAAATACCAATATGGATACAATTTGAGTAGTCCATATAGTTTTCATATAGAACTCTACTTGTCCTTACTTATCTGGAACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 59.30% | 40.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 81.50% | 18.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 28.60% | 71.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721447320 | G -> A | LOC_Os07g35810.1 | upstream_gene_variant ; 2497.0bp to feature; MODIFIER | silent_mutation | Average:53.336; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0721447320 | G -> A | LOC_Os07g35820.1 | downstream_gene_variant ; 767.0bp to feature; MODIFIER | silent_mutation | Average:53.336; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0721447320 | G -> A | LOC_Os07g35810-LOC_Os07g35820 | intergenic_region ; MODIFIER | silent_mutation | Average:53.336; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721447320 | NA | 8.73E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | 7.46E-07 | 7.47E-07 | mr1572 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | NA | 1.24E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | NA | 1.10E-07 | mr1862 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | 9.58E-06 | 9.70E-06 | mr1899 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | 3.79E-06 | 3.79E-06 | mr1899 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | 9.99E-06 | 9.93E-06 | mr1954 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | NA | 6.86E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | NA | 1.20E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | NA | 4.16E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | NA | 3.76E-07 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | NA | 2.43E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | NA | 1.91E-11 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | NA | 2.60E-14 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721447320 | NA | 5.23E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |