\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721447320:

Variant ID: vg0721447320 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21447320
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTCCAGATAAGTAAGGACAAGTAGAGTTCTATATGAAAACTATATGGACTACTCAAATTGTATCCATATTGGTATTTGTAGTTATGTTTGGACAATGG[G/A]
ACATCTATGGGTATAAATACAAGACCCCCTAAAGAAGGGGGAGGAGACCAACACAAGCCAAGACAAAGCCAGATATCGACATCAGAGATTAGCCTAGACA

Reverse complement sequence

TGTCTAGGCTAATCTCTGATGTCGATATCTGGCTTTGTCTTGGCTTGTGTTGGTCTCCTCCCCCTTCTTTAGGGGGTCTTGTATTTATACCCATAGATGT[C/T]
CCATTGTCCAAACATAACTACAAATACCAATATGGATACAATTTGAGTAGTCCATATAGTTTTCATATAGAACTCTACTTGTCCTTACTTATCTGGAACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 14.60% 0.00% 0.00% NA
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 59.30% 40.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 81.50% 18.50% 0.00% 0.00% NA
Tropical Japonica  504 28.60% 71.40% 0.00% 0.00% NA
Japonica Intermediate  241 53.10% 46.90% 0.00% 0.00% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721447320 G -> A LOC_Os07g35810.1 upstream_gene_variant ; 2497.0bp to feature; MODIFIER silent_mutation Average:53.336; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg0721447320 G -> A LOC_Os07g35820.1 downstream_gene_variant ; 767.0bp to feature; MODIFIER silent_mutation Average:53.336; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg0721447320 G -> A LOC_Os07g35810-LOC_Os07g35820 intergenic_region ; MODIFIER silent_mutation Average:53.336; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721447320 NA 8.73E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 7.46E-07 7.47E-07 mr1572 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 NA 1.24E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 NA 1.10E-07 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 9.58E-06 9.70E-06 mr1899 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 3.79E-06 3.79E-06 mr1899 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 9.99E-06 9.93E-06 mr1954 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 NA 6.86E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 NA 1.20E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 NA 4.16E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 NA 3.76E-07 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 NA 2.43E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 NA 1.91E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 NA 2.60E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721447320 NA 5.23E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251