Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721303635:

Variant ID: vg0721303635 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21303635
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GTCGAAAGCATTAGGACTTTTGATATTGCATTATCAAAAGCATACATCAAACAAAACGGAGGTCTTTCTTGCAAGCGTTAGATCTTTCTTGCAAGCGTCC[T/C]
CCCAAATTCGTCACTCTTACGCCGATACATCTCAACCTCCAACAAAACGGCAGCGGCCATGTCCATGTTCATCATCCACTCGAAGGCCTGACGGAGGTCT

Reverse complement sequence

AGACCTCCGTCAGGCCTTCGAGTGGATGATGAACATGGACATGGCCGCTGCCGTTTTGTTGGAGGTTGAGATGTATCGGCGTAAGAGTGACGAATTTGGG[A/G]
GGACGCTTGCAAGAAAGATCTAACGCTTGCAAGAAAGACCTCCGTTTTGTTTGATGTATGCTTTTGATAATGCAATATCAAAAGTCCTAATGCTTTCGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.70%	12.90%	0.83%	2.54%	NA
All Indica	2759	72.70%	21.90%	1.41%	3.95%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.07%	NA
Aus	269	96.70%	0.00%	0.00%	3.35%	NA
Indica I	595	27.60%	67.20%	5.04%	0.17%	NA
Indica II	465	86.90%	11.80%	0.22%	1.08%	NA
Indica III	913	90.40%	0.10%	0.44%	9.09%	NA
Indica Intermediate	786	78.10%	18.80%	0.51%	2.54%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	6.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721303635	T -> DEL	N	N	silent_mutation	Average:44.192; most accessible tissue: Zhenshan97 young leaf, score: 66.32	N	N	N	N
vg0721303635	T -> C	LOC_Os07g35580.1	upstream_gene_variant ; 4059.0bp to feature; MODIFIER	silent_mutation	Average:44.192; most accessible tissue: Zhenshan97 young leaf, score: 66.32	N	N	N	N
vg0721303635	T -> C	LOC_Os07g35600.2	downstream_gene_variant ; 4811.0bp to feature; MODIFIER	silent_mutation	Average:44.192; most accessible tissue: Zhenshan97 young leaf, score: 66.32	N	N	N	N
vg0721303635	T -> C	LOC_Os07g35600.1	intron_variant ; MODIFIER	silent_mutation	Average:44.192; most accessible tissue: Zhenshan97 young leaf, score: 66.32	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721303635	NA	1.79E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0721303635	NA	1.74E-17	Heading_date	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0721303635	NA	8.43E-11	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	9.00E-11	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	2.57E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	2.81E-06	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	2.56E-06	mr1125_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	1.39E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	6.60E-09	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	5.16E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	1.47E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	3.91E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	6.62E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	9.79E-07	mr1266_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	6.29E-06	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	9.54E-06	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635	NA	1.20E-07	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251