\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721303635:

Variant ID: vg0721303635 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21303635
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GTCGAAAGCATTAGGACTTTTGATATTGCATTATCAAAAGCATACATCAAACAAAACGGAGGTCTTTCTTGCAAGCGTTAGATCTTTCTTGCAAGCGTCC[T/C]
CCCAAATTCGTCACTCTTACGCCGATACATCTCAACCTCCAACAAAACGGCAGCGGCCATGTCCATGTTCATCATCCACTCGAAGGCCTGACGGAGGTCT

Reverse complement sequence

AGACCTCCGTCAGGCCTTCGAGTGGATGATGAACATGGACATGGCCGCTGCCGTTTTGTTGGAGGTTGAGATGTATCGGCGTAAGAGTGACGAATTTGGG[A/G]
GGACGCTTGCAAGAAAGATCTAACGCTTGCAAGAAAGACCTCCGTTTTGTTTGATGTATGCTTTTGATAATGCAATATCAAAAGTCCTAATGCTTTCGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 12.90% 0.83% 2.54% NA
All Indica  2759 72.70% 21.90% 1.41% 3.95% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.07% NA
Aus  269 96.70% 0.00% 0.00% 3.35% NA
Indica I  595 27.60% 67.20% 5.04% 0.17% NA
Indica II  465 86.90% 11.80% 0.22% 1.08% NA
Indica III  913 90.40% 0.10% 0.44% 9.09% NA
Indica Intermediate  786 78.10% 18.80% 0.51% 2.54% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721303635 T -> DEL N N silent_mutation Average:44.192; most accessible tissue: Zhenshan97 young leaf, score: 66.32 N N N N
vg0721303635 T -> C LOC_Os07g35580.1 upstream_gene_variant ; 4059.0bp to feature; MODIFIER silent_mutation Average:44.192; most accessible tissue: Zhenshan97 young leaf, score: 66.32 N N N N
vg0721303635 T -> C LOC_Os07g35600.2 downstream_gene_variant ; 4811.0bp to feature; MODIFIER silent_mutation Average:44.192; most accessible tissue: Zhenshan97 young leaf, score: 66.32 N N N N
vg0721303635 T -> C LOC_Os07g35600.1 intron_variant ; MODIFIER silent_mutation Average:44.192; most accessible tissue: Zhenshan97 young leaf, score: 66.32 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721303635 NA 1.79E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0721303635 NA 1.74E-17 Heading_date Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0721303635 NA 8.43E-11 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 9.00E-11 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 2.57E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 2.81E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 2.56E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 1.39E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 6.60E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 5.16E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 1.47E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 3.91E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 6.62E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 9.79E-07 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 6.29E-06 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 9.54E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721303635 NA 1.20E-07 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251