\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719776346:

Variant ID: vg0719776346 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19776346
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATAGCCGCACCTCCATAGCTCTATCCATGGCTTTGTGCTTCAGCAAGAAGAAGAATAAGAGAGGAAGGCAAATGGTGTGCTTGTACTCGCTGTGAGTT[T/C]
AATGGCGGCAACTACACACTGATGTGAAGACGAAGATAGAGAGTTTCCTTGACATCGGAACATACTGGACAAGCTGCTCACGTCGATTGGGCCAAAGCTA

Reverse complement sequence

TAGCTTTGGCCCAATCGACGTGAGCAGCTTGTCCAGTATGTTCCGATGTCAAGGAAACTCTCTATCTTCGTCTTCACATCAGTGTGTAGTTGCCGCCATT[A/G]
AACTCACAGCGAGTACAAGCACACCATTTGCCTTCCTCTCTTATTCTTCTTCTTGCTGAAGCACAAAGCCATGGATAGAGCTATGGAGGTGCGGCTATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 14.10% 0.21% 0.00% NA
All Indica  2759 99.20% 0.70% 0.04% 0.00% NA
All Japonica  1512 58.30% 41.10% 0.53% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.30% 0.13% 0.00% NA
Temperate Japonica  767 44.10% 54.90% 1.04% 0.00% NA
Tropical Japonica  504 88.70% 11.30% 0.00% 0.00% NA
Japonica Intermediate  241 40.20% 59.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719776346 T -> C LOC_Os07g33110.1 upstream_gene_variant ; 2859.0bp to feature; MODIFIER silent_mutation Average:92.146; most accessible tissue: Minghui63 young leaf, score: 98.039 N N N N
vg0719776346 T -> C LOC_Os07g33120.1 upstream_gene_variant ; 3153.0bp to feature; MODIFIER silent_mutation Average:92.146; most accessible tissue: Minghui63 young leaf, score: 98.039 N N N N
vg0719776346 T -> C LOC_Os07g33110.4 upstream_gene_variant ; 2973.0bp to feature; MODIFIER silent_mutation Average:92.146; most accessible tissue: Minghui63 young leaf, score: 98.039 N N N N
vg0719776346 T -> C LOC_Os07g33110.2 upstream_gene_variant ; 1842.0bp to feature; MODIFIER silent_mutation Average:92.146; most accessible tissue: Minghui63 young leaf, score: 98.039 N N N N
vg0719776346 T -> C LOC_Os07g33110.3 upstream_gene_variant ; 1842.0bp to feature; MODIFIER silent_mutation Average:92.146; most accessible tissue: Minghui63 young leaf, score: 98.039 N N N N
vg0719776346 T -> C LOC_Os07g33110.5 upstream_gene_variant ; 1842.0bp to feature; MODIFIER silent_mutation Average:92.146; most accessible tissue: Minghui63 young leaf, score: 98.039 N N N N
vg0719776346 T -> C LOC_Os07g33110-LOC_Os07g33120 intergenic_region ; MODIFIER silent_mutation Average:92.146; most accessible tissue: Minghui63 young leaf, score: 98.039 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0719776346 T C -0.09 -0.04 -0.02 -0.02 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719776346 1.05E-06 NA Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719776346 3.25E-06 NA Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719776346 3.71E-11 NA Spikelet_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719776346 3.23E-08 NA Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719776346 1.83E-06 2.12E-22 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719776346 NA 2.69E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719776346 NA 2.09E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719776346 NA 6.71E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719776346 NA 3.77E-21 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719776346 NA 4.74E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719776346 NA 2.37E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719776346 NA 7.16E-09 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251