Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0719775322:

Variant ID: vg0719775322 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19775322
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

AACTGATAATATGCAAAATGTTATATTAGATATTCAAAGTTGTTCGATTAAGATTTCAATATATGCAAAACCACCTTAGACGGTAATATGAATGGTATTG[T/C]
AAATTTTAGGGGGTTGGATGTCCAGTTTAAAGTTCAAGGTACTAGATGGACTTTCATCTAAAGTTTAGACGGTAATATGAACGGTATTGCAAATTTTAGG

Reverse complement sequence

CCTAAAATTTGCAATACCGTTCATATTACCGTCTAAACTTTAGATGAAAGTCCATCTAGTACCTTGAACTTTAAACTGGACATCCAACCCCCTAAAATTT[A/G]
CAATACCATTCATATTACCGTCTAAGGTGGTTTTGCATATATTGAAATCTTAATCGAACAACTTTGAATATCTAATATAACATTTTGCATATTATCAGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	37.90%	2.48%	0.00%	NA
All Indica	2759	66.30%	29.80%	3.84%	0.00%	NA
All Japonica	1512	44.20%	55.50%	0.26%	0.00%	NA
Aus	269	68.40%	30.90%	0.74%	0.00%	NA
Indica I	595	71.40%	21.00%	7.56%	0.00%	NA
Indica II	465	63.40%	32.50%	4.09%	0.00%	NA
Indica III	913	66.80%	31.90%	1.31%	0.00%	NA
Indica Intermediate	786	63.60%	32.60%	3.82%	0.00%	NA
Temperate Japonica	767	42.10%	57.60%	0.26%	0.00%	NA
Tropical Japonica	504	56.20%	43.80%	0.00%	0.00%	NA
Japonica Intermediate	241	26.10%	73.00%	0.83%	0.00%	NA
VI/Aromatic	96	83.30%	15.60%	1.04%	0.00%	NA
Intermediate	90	58.90%	36.70%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719775322	T -> C	LOC_Os07g33110.1	upstream_gene_variant ; 1835.0bp to feature; MODIFIER	silent_mutation	Average:45.079; most accessible tissue: Callus, score: 86.598	N	N	N	N
vg0719775322	T -> C	LOC_Os07g33120.1	upstream_gene_variant ; 4177.0bp to feature; MODIFIER	silent_mutation	Average:45.079; most accessible tissue: Callus, score: 86.598	N	N	N	N
vg0719775322	T -> C	LOC_Os07g33110.4	upstream_gene_variant ; 1949.0bp to feature; MODIFIER	silent_mutation	Average:45.079; most accessible tissue: Callus, score: 86.598	N	N	N	N
vg0719775322	T -> C	LOC_Os07g33110.2	upstream_gene_variant ; 818.0bp to feature; MODIFIER	silent_mutation	Average:45.079; most accessible tissue: Callus, score: 86.598	N	N	N	N
vg0719775322	T -> C	LOC_Os07g33110.3	upstream_gene_variant ; 818.0bp to feature; MODIFIER	silent_mutation	Average:45.079; most accessible tissue: Callus, score: 86.598	N	N	N	N
vg0719775322	T -> C	LOC_Os07g33110.5	upstream_gene_variant ; 818.0bp to feature; MODIFIER	silent_mutation	Average:45.079; most accessible tissue: Callus, score: 86.598	N	N	N	N
vg0719775322	T -> C	LOC_Os07g33110-LOC_Os07g33120	intergenic_region ; MODIFIER	silent_mutation	Average:45.079; most accessible tissue: Callus, score: 86.598	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719775322	2.92E-06	NA	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719775322	2.21E-06	NA	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719775322	8.97E-06	NA	Plant_height	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719775322	1.01E-08	NA	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719775322	2.68E-07	NA	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719775322	1.20E-07	1.09E-23	mr1679	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322	NA	7.39E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322	NA	3.12E-09	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322	NA	2.13E-11	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322	NA	1.98E-06	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322	NA	4.25E-22	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322	NA	1.60E-06	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322	NA	3.33E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719775322	NA	9.16E-10	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251