Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718995839:

Variant ID: vg0718995839 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 18995839
Reference Allele: GATGTTAAlternative Allele: AATGTTA,G
Primary Allele: GATGTTASecondary Allele: AATGTTA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGATGACGACAAGCTACAGTTCTCGACTCTATGTTCAGTTGTTTCCGAACTAACCAAAGAGTCGGGGGCTACACAAATACAAGACTCAAAATACGACA[GATGTTA/AATGTTA,G]
TGTCAACATGAAGCAATCAATTAACCAGCCAATGAGTCATTATCTTCGTCTTCGCTTCCGAGCAAGCTTTCTACTTCATCAACTCTAATTATTTCACCAA

Reverse complement sequence

TTGGTGAAATAATTAGAGTTGATGAAGTAGAAAGCTTGCTCGGAAGCGAAGACGAAGATAATGACTCATTGGCTGGTTAATTGATTGCTTCATGTTGACA[TAACATC/TAACATT,C]
TGTCGTATTTTGAGTCTTGTATTTGTGTAGCCCCCGACTCTTTGGTTAGTTCGGAAACAACTGAACATAGAGTCGAGAACTGTAGCTTGTCGTCATCGAG

Allele Frequencies:

Populations Population SizeFrequency of GATGTTA(primary allele) Frequency of AATGTTA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 10.60% 0.00% 0.00% NA
All Indica  2759 99.20% 0.80% 0.00% 0.00% NA
All Japonica  1512 70.30% 29.70% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 32.70% 67.30% 0.00% 0.00% NA
Japonica Intermediate  241 63.10% 36.90% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718995839 GATGTTA -> G LOC_Os07g31930.1 downstream_gene_variant ; 358.0bp to feature; MODIFIER N Average:25.52; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0718995839 GATGTTA -> G LOC_Os07g31920-LOC_Os07g31930 intergenic_region ; MODIFIER N Average:25.52; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0718995839 GATGTTA -> AATGTTA LOC_Os07g31930.1 downstream_gene_variant ; 359.0bp to feature; MODIFIER silent_mutation Average:25.52; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0718995839 GATGTTA -> AATGTTA LOC_Os07g31920-LOC_Os07g31930 intergenic_region ; MODIFIER silent_mutation Average:25.52; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718995839 8.78E-07 NA Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718995839 NA 8.65E-19 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718995839 5.36E-09 1.55E-15 Grain_weight All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718995839 NA 5.88E-06 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718995839 NA 1.41E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 6.52E-07 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.74E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 5.94E-08 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 3.48E-06 NA mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 1.71E-06 4.04E-11 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.39E-07 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 5.07E-07 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.09E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.54E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.99E-07 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 9.41E-22 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 5.32E-06 mr1383 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.55E-07 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.15E-16 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 9.39E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.21E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 8.89E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 4.66E-06 3.16E-07 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 5.78E-06 8.03E-09 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.92E-08 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 3.14E-25 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.34E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.64E-08 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.75E-16 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 1.20E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718995839 NA 7.14E-13 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251