Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718793205:

Variant ID: vg0718793205 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18793205
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAAAATGTTTTTCCGATACTTTTGGTACCTCGTCCGTATTTAGGTCGGTTTTTAAGTTTGTTTGCTTTTCAAAATACATAAGGAGTCATATAAAAAATC[T/C]
TTTTAAAAAACTTGCATGCTAACTTAAGACAAGAGTCATACTCCTAATTGCTTCAGAATTCTTTTCAGGTGATAAGAAAGCACCGTACATGATATGGCCA

Reverse complement sequence

TGGCCATATCATGTACGGTGCTTTCTTATCACCTGAAAAGAATTCTGAAGCAATTAGGAGTATGACTCTTGTCTTAAGTTAGCATGCAAGTTTTTTAAAA[A/G]
GATTTTTTATATGACTCCTTATGTATTTTGAAAAGCAAACAAACTTAAAAACCGACCTAAATACGGACGAGGTACCAAAAGTATCGGAAAAACATTTTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.80%	11.00%	4.42%	33.83%	NA
All Indica	2759	38.20%	3.70%	5.91%	52.23%	NA
All Japonica	1512	66.70%	26.00%	2.12%	5.22%	NA
Aus	269	92.60%	0.00%	0.37%	7.06%	NA
Indica I	595	53.30%	0.80%	5.55%	40.34%	NA
Indica II	465	38.90%	9.90%	9.03%	42.15%	NA
Indica III	913	25.40%	1.30%	5.26%	68.02%	NA
Indica Intermediate	786	41.10%	5.00%	5.09%	48.85%	NA
Temperate Japonica	767	94.50%	2.50%	0.52%	2.48%	NA
Tropical Japonica	504	30.00%	59.90%	3.37%	6.75%	NA
Japonica Intermediate	241	54.80%	29.90%	4.56%	10.79%	NA
VI/Aromatic	96	54.20%	4.20%	5.21%	36.46%	NA
Intermediate	90	42.20%	21.10%	8.89%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718793205	T -> DEL	N	N	silent_mutation	Average:17.8; most accessible tissue: Callus, score: 43.175	N	N	N	N
vg0718793205	T -> C	LOC_Os07g31640.1	upstream_gene_variant ; 4884.0bp to feature; MODIFIER	silent_mutation	Average:17.8; most accessible tissue: Callus, score: 43.175	N	N	N	N
vg0718793205	T -> C	LOC_Os07g31640-LOC_Os07g31650	intergenic_region ; MODIFIER	silent_mutation	Average:17.8; most accessible tissue: Callus, score: 43.175	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718793205	1.08E-07	NA	Grain_length	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718793205	NA	1.45E-20	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718793205	1.21E-07	5.36E-14	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718793205	NA	1.15E-08	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	9.74E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	1.60E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	4.77E-20	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	6.25E-09	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	9.71E-06	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	2.67E-15	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	1.95E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	3.18E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	4.73E-07	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	1.49E-24	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	8.39E-07	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	3.49E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	2.59E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	2.57E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205	NA	4.55E-13	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251