\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718793205:

Variant ID: vg0718793205 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18793205
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAAATGTTTTTCCGATACTTTTGGTACCTCGTCCGTATTTAGGTCGGTTTTTAAGTTTGTTTGCTTTTCAAAATACATAAGGAGTCATATAAAAAATC[T/C]
TTTTAAAAAACTTGCATGCTAACTTAAGACAAGAGTCATACTCCTAATTGCTTCAGAATTCTTTTCAGGTGATAAGAAAGCACCGTACATGATATGGCCA

Reverse complement sequence

TGGCCATATCATGTACGGTGCTTTCTTATCACCTGAAAAGAATTCTGAAGCAATTAGGAGTATGACTCTTGTCTTAAGTTAGCATGCAAGTTTTTTAAAA[A/G]
GATTTTTTATATGACTCCTTATGTATTTTGAAAAGCAAACAAACTTAAAAACCGACCTAAATACGGACGAGGTACCAAAAGTATCGGAAAAACATTTTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 11.00% 4.42% 33.83% NA
All Indica  2759 38.20% 3.70% 5.91% 52.23% NA
All Japonica  1512 66.70% 26.00% 2.12% 5.22% NA
Aus  269 92.60% 0.00% 0.37% 7.06% NA
Indica I  595 53.30% 0.80% 5.55% 40.34% NA
Indica II  465 38.90% 9.90% 9.03% 42.15% NA
Indica III  913 25.40% 1.30% 5.26% 68.02% NA
Indica Intermediate  786 41.10% 5.00% 5.09% 48.85% NA
Temperate Japonica  767 94.50% 2.50% 0.52% 2.48% NA
Tropical Japonica  504 30.00% 59.90% 3.37% 6.75% NA
Japonica Intermediate  241 54.80% 29.90% 4.56% 10.79% NA
VI/Aromatic  96 54.20% 4.20% 5.21% 36.46% NA
Intermediate  90 42.20% 21.10% 8.89% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718793205 T -> DEL N N silent_mutation Average:17.8; most accessible tissue: Callus, score: 43.175 N N N N
vg0718793205 T -> C LOC_Os07g31640.1 upstream_gene_variant ; 4884.0bp to feature; MODIFIER silent_mutation Average:17.8; most accessible tissue: Callus, score: 43.175 N N N N
vg0718793205 T -> C LOC_Os07g31640-LOC_Os07g31650 intergenic_region ; MODIFIER silent_mutation Average:17.8; most accessible tissue: Callus, score: 43.175 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718793205 1.08E-07 NA Grain_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718793205 NA 1.45E-20 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718793205 1.21E-07 5.36E-14 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718793205 NA 1.15E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 9.74E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 1.60E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 4.77E-20 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 6.25E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 9.71E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 2.67E-15 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 1.95E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 3.18E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 4.73E-07 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 1.49E-24 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 8.39E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 3.49E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 2.59E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 2.57E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793205 NA 4.55E-13 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251