\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718793112:

Variant ID: vg0718793112 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18793112
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACATATAAATTGCTCCAACAAACTCCTTTTCACCCATTAGAAAATATATAACAACACTTAAATCGAACAAAAATCTCTACTATTTTAAAAATTGAAAAT[G/A]
TTTTTCCGATACTTTTGGTACCTCGTCCGTATTTAGGTCGGTTTTTAAGTTTGTTTGCTTTTCAAAATACATAAGGAGTCATATAAAAAATCTTTTTAAA

Reverse complement sequence

TTTAAAAAGATTTTTTATATGACTCCTTATGTATTTTGAAAAGCAAACAAACTTAAAAACCGACCTAAATACGGACGAGGTACCAAAAGTATCGGAAAAA[C/T]
ATTTTCAATTTTTAAAATAGTAGAGATTTTTGTTCGATTTAAGTGTTGTTATATATTTTCTAATGGGTGAAAAGGAGTTTGTTGGAGCAATTTATATGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 9.40% 4.61% 35.51% NA
All Indica  2759 37.70% 1.60% 5.87% 54.87% NA
All Japonica  1512 67.60% 24.80% 2.31% 5.29% NA
Aus  269 90.30% 1.10% 1.12% 7.43% NA
Indica I  595 52.60% 0.00% 4.87% 42.52% NA
Indica II  465 38.90% 4.30% 9.89% 46.88% NA
Indica III  913 25.20% 0.30% 3.83% 70.65% NA
Indica Intermediate  786 40.20% 2.50% 6.62% 50.64% NA
Temperate Japonica  767 95.30% 1.60% 1.04% 2.09% NA
Tropical Japonica  504 30.40% 58.90% 2.78% 7.94% NA
Japonica Intermediate  241 57.30% 27.40% 5.39% 9.96% NA
VI/Aromatic  96 45.80% 2.10% 11.46% 40.62% NA
Intermediate  90 43.30% 21.10% 7.78% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718793112 G -> DEL N N silent_mutation Average:17.41; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0718793112 G -> A LOC_Os07g31640.1 upstream_gene_variant ; 4791.0bp to feature; MODIFIER silent_mutation Average:17.41; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0718793112 G -> A LOC_Os07g31640-LOC_Os07g31650 intergenic_region ; MODIFIER silent_mutation Average:17.41; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718793112 1.26E-06 NA Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718793112 NA 1.41E-22 Grain_length Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718793112 NA 3.33E-13 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718793112 NA 6.48E-09 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 2.03E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 6.43E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 2.52E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 2.79E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 9.70E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 2.33E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 1.77E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 4.08E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 1.49E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 1.34E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 1.33E-21 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 1.30E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 5.76E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 1.42E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 5.33E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112 NA 3.95E-12 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251