Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718793112:

Variant ID: vg0718793112 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18793112
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACATATAAATTGCTCCAACAAACTCCTTTTCACCCATTAGAAAATATATAACAACACTTAAATCGAACAAAAATCTCTACTATTTTAAAAATTGAAAAT[G/A]
TTTTTCCGATACTTTTGGTACCTCGTCCGTATTTAGGTCGGTTTTTAAGTTTGTTTGCTTTTCAAAATACATAAGGAGTCATATAAAAAATCTTTTTAAA

Reverse complement sequence

TTTAAAAAGATTTTTTATATGACTCCTTATGTATTTTGAAAAGCAAACAAACTTAAAAACCGACCTAAATACGGACGAGGTACCAAAAGTATCGGAAAAA[C/T]
ATTTTCAATTTTTAAAATAGTAGAGATTTTTGTTCGATTTAAGTGTTGTTATATATTTTCTAATGGGTGAAAAGGAGTTTGTTGGAGCAATTTATATGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.50%	9.40%	4.61%	35.51%	NA
All Indica	2759	37.70%	1.60%	5.87%	54.87%	NA
All Japonica	1512	67.60%	24.80%	2.31%	5.29%	NA
Aus	269	90.30%	1.10%	1.12%	7.43%	NA
Indica I	595	52.60%	0.00%	4.87%	42.52%	NA
Indica II	465	38.90%	4.30%	9.89%	46.88%	NA
Indica III	913	25.20%	0.30%	3.83%	70.65%	NA
Indica Intermediate	786	40.20%	2.50%	6.62%	50.64%	NA
Temperate Japonica	767	95.30%	1.60%	1.04%	2.09%	NA
Tropical Japonica	504	30.40%	58.90%	2.78%	7.94%	NA
Japonica Intermediate	241	57.30%	27.40%	5.39%	9.96%	NA
VI/Aromatic	96	45.80%	2.10%	11.46%	40.62%	NA
Intermediate	90	43.30%	21.10%	7.78%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718793112	G -> DEL	N	N	silent_mutation	Average:17.41; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0718793112	G -> A	LOC_Os07g31640.1	upstream_gene_variant ; 4791.0bp to feature; MODIFIER	silent_mutation	Average:17.41; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0718793112	G -> A	LOC_Os07g31640-LOC_Os07g31650	intergenic_region ; MODIFIER	silent_mutation	Average:17.41; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718793112	1.26E-06	NA	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718793112	NA	1.41E-22	Grain_length	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718793112	NA	3.33E-13	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718793112	NA	6.48E-09	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	2.03E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	6.43E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	2.52E-06	mr1246	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	2.79E-06	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	9.70E-06	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	2.33E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	1.77E-14	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	4.08E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	1.49E-06	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	1.34E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	1.33E-21	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	1.30E-09	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	5.76E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	1.42E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	5.33E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718793112	NA	3.95E-12	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251