\
| Variant ID: vg0715801688 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15801688 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTAATCTCGAGAACGCAAGCCGCCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTTGAAACAAAA[T/C,A]
GAAAGTAAAAAGGGTGGTGATGCGCCGAGATTATATTGAACGTCTGTTAATTGATACATGGGGTTCGGGGTCTATTTATACCCGAGAATTACAAGATATG
CATATCTTGTAATTCTCGGGTATAAATAGACCCCGAACCCCATGTATCAATTAACAGACGTTCAATATAATCTCGGCGCATCACCACCCTTTTTACTTTC[A/G,T]
TTTTGTTTCAACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGGCGGCTTGCGTTCTCGAGATTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 11.40% | 0.34% | 0.06% | A: 0.15% |
| All Indica | 2759 | 98.40% | 1.10% | 0.25% | 0.11% | A: 0.18% |
| All Japonica | 1512 | 66.60% | 33.30% | 0.07% | 0.00% | A: 0.07% |
| Aus | 269 | 97.00% | 0.00% | 2.60% | 0.00% | A: 0.37% |
| Indica I | 595 | 99.50% | 0.20% | 0.00% | 0.00% | A: 0.34% |
| Indica II | 465 | 97.40% | 2.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.90% | 0.40% | 0.11% | 0.33% | A: 0.22% |
| Indica Intermediate | 786 | 97.60% | 1.70% | 0.64% | 0.00% | A: 0.13% |
| Temperate Japonica | 767 | 38.50% | 61.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 8.70% | 0.41% | 0.00% | A: 0.41% |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715801688 | T -> DEL | N | N | silent_mutation | Average:30.685; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 | N | N | N | N |
| vg0715801688 | T -> A | LOC_Os07g27200.1 | upstream_gene_variant ; 740.0bp to feature; MODIFIER | silent_mutation | Average:30.685; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 | N | N | N | N |
| vg0715801688 | T -> A | LOC_Os07g27190-LOC_Os07g27200 | intergenic_region ; MODIFIER | silent_mutation | Average:30.685; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 | N | N | N | N |
| vg0715801688 | T -> C | LOC_Os07g27200.1 | upstream_gene_variant ; 740.0bp to feature; MODIFIER | silent_mutation | Average:30.685; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 | N | N | N | N |
| vg0715801688 | T -> C | LOC_Os07g27190-LOC_Os07g27200 | intergenic_region ; MODIFIER | silent_mutation | Average:30.685; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715801688 | NA | 3.32E-13 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0715801688 | NA | 8.82E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 5.05E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 2.08E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 1.18E-10 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 2.19E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 3.29E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 9.87E-06 | mr1332 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 7.80E-06 | mr1353 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 2.96E-06 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | 1.25E-07 | 1.24E-07 | mr1703 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 6.40E-11 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 6.89E-09 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 9.32E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 3.67E-09 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 3.26E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 2.94E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715801688 | NA | 8.36E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |