\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715799303:

Variant ID: vg0715799303 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15799303
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAACTCGCCTTCGGATGTGCTAGCATGCCAGTTGATTTGATCCTGCAATCAACAAGAAACAAAAACAAAGAAACCGCGGTTAAATCCATAAATGATAGC[T/C]
GATCGGCTAGGTGTCGATGACATATCATTGACCAGGCCCGATGTCATATATACATCGATTGGCAAGCATTAATAAACAAATCAGAACTAAATCTACTCGA

Reverse complement sequence

TCGAGTAGATTTAGTTCTGATTTGTTTATTAATGCTTGCCAATCGATGTATATATGACATCGGGCCTGGTCAATGATATGTCATCGACACCTAGCCGATC[A/G]
GCTATCATTTATGGATTTAACCGCGGTTTCTTTGTTTTTGTTTCTTGTTGATTGCAGGATCAAATCAACTGGCATGCTAGCACATCCGAAGGCGAGTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 15.30% 0.06% 0.30% NA
All Indica  2759 98.00% 1.70% 0.07% 0.25% NA
All Japonica  1512 66.80% 33.20% 0.00% 0.00% NA
Aus  269 34.90% 62.50% 0.00% 2.60% NA
Indica I  595 99.30% 0.30% 0.34% 0.00% NA
Indica II  465 97.20% 2.60% 0.00% 0.22% NA
Indica III  913 99.50% 0.40% 0.00% 0.11% NA
Indica Intermediate  786 95.80% 3.60% 0.00% 0.64% NA
Temperate Japonica  767 38.50% 61.50% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 90.90% 9.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715799303 T -> DEL N N silent_mutation Average:46.324; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N
vg0715799303 T -> C LOC_Os07g27200.1 upstream_gene_variant ; 3125.0bp to feature; MODIFIER silent_mutation Average:46.324; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N
vg0715799303 T -> C LOC_Os07g27190-LOC_Os07g27200 intergenic_region ; MODIFIER silent_mutation Average:46.324; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715799303 NA 2.66E-13 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0715799303 NA 8.91E-06 mr1171 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 1.89E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 1.00E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 1.06E-10 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 3.89E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 9.02E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 4.78E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 1.55E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 2.31E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 8.64E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 8.05E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 1.51E-06 1.51E-06 mr1703 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 4.28E-12 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 1.96E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 3.26E-10 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 7.13E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 3.96E-10 mr1880 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 3.08E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 1.13E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 3.01E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 6.49E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 4.44E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715799303 NA 1.31E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251